ZFIN ID: ZDB-TSCRIPT-090929-1974
Transcript Name: malt3-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011449 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011449|OTTDARG00000009974|ZDB-GENE-050419-182 si:dkey-77f17.1|OTTDARP00000009864 DKEY-77F17.1-001 LG_ AL935332.12 Danio rerio protein_coding NOVEL, 2006 bp
TTTCTCGTCAATTCTATTGACGCTCTGTGCTAGTGTGCAT
GAAGAGCTTTAGGAAGAGAAAGTGACAGAAATCTCAGTCA
TACTGATATAGCAATGAGCAGCAGGACAGGTGACAAAATT
GTGAAATGACTGACTACCTTAAAAGGTCTTGGCCCTCAAC
ACTAAAGAGTAGCACGATAGTCATGAGAACGGAAGTTGTT
ATTCTTCAGCAGCCGTTGCCTGTTTGTGTACCACCAAACC
ATGAGGTAACTTTAAGGGTTCAAGCAAAAGGCACTGGTGC
ACTGAAATATCAGTGGTTTGATAAACAGCAGACAGAGGTG
GTAGGTGGGACAGAACCCGAGCTCACCGTCAGTCTCCAGA
GGTCTGGAAATTATGTTTGCAGAGTGAGCGACCTGTACTG
TAACTATCAGTTCACCGAATGGGTGAAAGTGAGAATCTTA
GATGAAGCAGGTGTTTCTAACACATGGAGAGGGGAACCCC
ATGTTGTCATTCACCCGAAAAGCCAAACCATTAAACCAGG
GGAGACTTTCACTCTTAAATGCACTGCGTTGGGCAAGCCC
GCACCAACCTACCAGTGGTATAGAAATGGTCGCATCCTTA
CTGAAGAGACCAAAGAAACACTCAAGGTAGAAAATGCTGG
GGCAGAGGTTGCTGGTTCATACCTCTGTGCTGTGTCAAAT
ATTTTGGAGGAGAGATGGTCTGAAGCAGCTGAAATTGAGA
TTGCACCTCCAGATCAGCTACCAACAACCACGCTTATGGC
AACCGACAAAGTGGCATTACTGATTGGGAACCTGAACTAC
AGCCACCATCCCGGTTTGATGGCCCCTACCATGGATGTCC
ATGAGCTGGCCAATCTTCTGCAGCAGCTGGATTTCAGAGT
GGTTTCTCTGCTTGATCTCACCCTTGAAGAAATGCAGGCG
GCCATTGACAAATTTCTGCAGCTCTTGGACCGTGGAGTGT
ATGCTGTTTTTTACTACGCTGGCCATGGCTATGAGCACGC
CGGCCGAAATTACCTGGTGGCCATTGATGCTCCACGGCCC
TACCGTACAGAAAATTGTGTGTGTGTACAGAGAGTAATGC
GCAGCATGCAGGAAAGAAAAGCGCAGCTCAACGTCATTCT
CCTGGACACCTGCAGGAAATGGTACAATCAAAAAGGCCCT
CCCTCTGAAATTAAGCCTTTGGCTCCTCTGGGCAACACTG
TGTATGGATACGCCACGAGTGAAGATGCAGAGGCTTTCGA
GGTTCAAGACGGTGGCAAGAGCACGGGGATCTTCACCAAG
TACCTTAACAAACATGTCTTACAGCCAGAGAGGGTGACAC
GAGTCTTAGAGCAGGTCTCTGAAGATTTGGGAAAGGACCC
ACTGGTTCGCGGCAGGCAGGTTGTGGAGATCAGACACACT
CTGATGGAGCCACGGGCTTTGACTGATCCTGTGCGAACAT
CTGGACACACCATGGAGCTCCGCCGCCGTGATGCTTATTG
GAAACAGGCTAATGTTCTTCCTGGTCGAAGGACTCTGCGC
TTTCATCACAGTGGTGTCCAGGTGGAGCTCAATTTCTCTG
CGCTGTTCTCCAATGTCCTGGTTGTGTTTGGTACGGTGAG
GAACACGAGCGCCATGGCCCAGGACTGCACTCTCATTCTT
GAAAGCGAACCAAATCTGCAGGACATTTTCTCAGCTTCGG
GCAGATCAGAGGAAATGGACTCCTTGTTTGTGAGCGGTGG
TCAAACTCCTGACTGCACACTCAGATTATGTTGCCTTCAA
AGACTCCAGGGATCTGTGGTGATCAGGGCTAAACTGCACT
ATACTCATGCACAAACTAAAGAGCGTCTGACAGAGAGCAG
AGAGGTGGACATAGACAGACCTCTCATCTCCTCCTGCAAA
CTCAACCAGATGAAGACTGTGGACAGAAGACAAGATGCTC
GAGGCCACACTCTGGACCACATGTCTAACATTAGATGGTC
TCAGCATCATCGTCCTCATCATCATCAGCAGCAGAACCAT
TCTCGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
malt3-001 Contained in:
OTHER malt3-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000011449 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN895125 (1) 749bp
    GenBank:AW423112 (1) 684bp
    CITATIONS (1)