header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19712
Transcript Name: snx17-201
Previous Name: snx17-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039416 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039416|OTTDARG00000028808|ZDB-GENE-030131-9475 snx17|OTTDARP00000031527 snx17-001 LG_ BX276101.6 Danio rerio protein_coding KNOWN, 4379 bp
CGCTCATGCCAATGCATCTCAACTGAACGTTTTTACGCAA
TAACTCCCCCCGCGGCAGGAGAATGGTTTGATCCAGACTG
TTGCAATGCTTCGGCAGAGCGCAGATACATATTGAATACA
TTACAGCACAGCGGCTTAATCATACGCGGCTCTGGAAGGT
ATCTCTACAATGTAAACTGATGTGTGCTCTTCCTAACGTC
CTAACAAGAACGAACACTGCATCGCCATCTCGAAATGCAG
GCTGCGACAAACAGTTTCTTCATTTGTTTCCTCTCCATAC
TCGCTCGTATGTACCAACGTAGGTAGAAACGGGGGCTGTG
GAGAAGCGCGGAGCACCTTTACGTGGAGTAAATCTGAAAG
TTAATTAGACCGCGGGCCTTGCGTGAGTTTACAGACTCGA
TTTCCACATTGATTTACAGTGTACGAGGAAGTGAGGGGAC
AGATTTGGACATGGGTTGCCTACAATGAACGTGGAATTAC
CTCTAGCTGCAACATGGCTGCTGCTTAGATGTTTAGTTTC
TGGAAAAGTTCAGCCTTGAGCATTTGGAAAGTTTTATAAA
TAGTCCACTTTGTAGAAAAATAACTTTTCTGTCGTGATAC
AACTGCGGATTGAACTGGACTGGATTGGACGACACTGGGA
TTCAGAGCGAGTGAGGCTCGCCGTCATTCAGTTTTGCTCT
CTGCATGACAGCAACGCAACAGCAAGGGCTTTCCGCGAAC
ATTCTCGCTTTTGTCAGCATTGTGAACTTGGTCAAAGACG
TTCAGCTTCACTGGAGAAAATGCATTTCTCCATTCCTGAG
ACGGAGGTCCGCTCCGATGAAAACGGATCTTCGTATGTGG
CTTACAATATTCATGTGAATGGCGTCTTGCATTGTCGAGT
ACGATACAGCCAACTCTTGGGCCTTCATGAACAGATAAAA
AAAGAATATGGAAATAACGTGGTGCCTGCTTTTCCACCAA
AGAAGATCTTTACTCTCACACCGGCTGAAGTCGATCAGAG
AAGAGAACAGCTGGAGAAGTACATGCAAGCTGTGCGTCAG
GACCCCATTCTGGGATCCAGTGAGATGTTCAACAGCTTTT
TGAGGAAAGCTCAACAGGAGACCCAGCAGATCCCCACTGA
AGAGGTGCAGCTGGAGATCTACCTGTCCAACGGCCAGAAG
GTCAAAGTCAACATCCTCACATCTGACCAGACCGAGGACG
TTCTGGAGGCGGTGGCCTCAAAGCTTGACCTTCCCGACGA
GCTGGTGGGATATTTCAGCCTGTTCCTGGTTCAGGAGAGG
GCTGACGGCAGCTGCACGTACGTGAGAAAACTGCAGGAGT
TTGAGCTGCCCTACGTGTCCATCACCAGCCTGCACAGTTC
AGACTATCGAATCATCCTACGAAAGAGCTACTGGGACACG
GCGTACGACAGTGATGTCATGGATGATCGTGTGGGACTCA
ACTTATTATACGCTCAGACGGTGTCAGACATTGACCGAGG
ATGGATCCTGGTAAACAAAGAGCAGCACAGACAGCTGAAA
TCCCTGCAGGAGAAGGGCTCAAAGAAGGAGTTCATCAGAT
TGGCTCAGACACTGAAGTACTACGGCTATATCAAGTTTGA
TCCCTGCATCACAGATTTTCCAGAGAAGGGCTGTCATGTT
ATAGTCGGAGCTGGAAACAATGAGCTCAACTTCCACGTCA
AGCTGCCCAACGAGCAGATGAAAGAGGGCAGCTTCAAAGT
CACGCGCATGAGATGCTGGCGGGTCACGTCATCTCAGGTG
CCGGTGGCCAACGGTACCGCAAACCCCAGCAGCTCCAGTA
AATGTGATGTGAAGCTTGAGCTGGCCTTCGAGTACTTGAT
GAGCAAAGACCGTCTGCAGTGGGTCACCATCACCAGTCAA
CAGGCTATCATGATGAGCATCTGTCTGCAGTCTATGGTAG
ATGAGCTGATGGTGAAAAAATCTGGCGGAAGCATTAAAAA
GCAGATGCAGAAGAAGCGACTGAATGGCTCGTTACAGCGC
TCTGACAGTCAGCAAGCTGTGAAGTCTCCTCCAATACTGG
ATTCTCCCGATCCCAACCGTGAACAAGTAGTCAAACTTTC
GACCAAGCTGTCTTCTGTCTCCCTGAGAGGACTTAGTTCT
TCCAACTCAGCGGGGGACATCAGTGGCAATGACTTTCATG
GAAACTACGCCTTTGAAGGAATAGGGGACGATGACCTGTG
ATGCAGCCGTCCTTAAAGACCGGAATGAAGGAGGCAGATT
CATTTAGCGCTTTCGCTGAGCTGAGTTTCTCTGAGCGTAG
TTCAAAAGATGCCCAGTTCTGCAATATCGTAAACCCTTCC
AGAAAAAAAATTTAATCGCATCAACAGCTCGAAATATTGC
TGACAAAGTACAACAGTTTGACTCGAGTCTCTAATTCGTG
AGTGAATGAGATCCAGCTCACGTTCAATTAGTCACAGCAA
TTAGATATAAACCTTGGAGACTATGAAATGAATCCAGGGC
TACATATTCACCTCAGGGCGAGTTACTGCATTCATTTAGA
CTGTGATGAAAGTTTAATCTTCAGACGGGCTTCAGTGAAT
CAAACTTCCTTACTAGAGACACAAAACTGTGCTTTTTTCT
CTCATTTTGTCAACATCAAGTTTTGCTCTTGCCTACTAGA
CTAAGATCCATACCAGCAAACTGTGTTGATATGCTTCTAT
TTAAATCCTTTATTTCACAGAGAAAAGGATCTGCTTCATT
TCGTGACTTCTGGCGTGATAAATCAGCTTCCTGTTTTCTT
CAGGAGAGGTAATATTGTGGCTTATTCAACTTCATTCATT
GCACATCCTAGAAAAATACACAAGTTCAGAATGAAAGCCA
CCCTCTTTATTGTGGCCTACTTTCTGCTGATTCAACAGTT
CAGCTTCTCTAAATGAAAATATATGTAGCGCCAGACACAA
GTTGGCTAAAAAGCTTCTCTCATTCAAGCCTTGGCTGTGT
CTTGAATCTTGTTTTGGTGTGTTCGGCAGGCCCGCTTGCA
CTAGCTCAGCTCTTTTTTATTTTATTTTTGAAGCACAGTA
TTAAGAAAAGAGGGGGATAGGGTGTGCGTTGAGGTGGGCA
AACATCCTGGAACATTGGCAAGAGGTTTGCAGATCTGCCA
TTTATGTGTGCATTTGATGTTTGTTCTGTTATTCATACCA
ATATATTAAAAAAGTTTCTCATAAATGCCAAATTATAGTT
CACTAAAGCATTTTGCACAAAGTAAAATCATGGTAATGTC
ACTTTTCTTGTTTTTGTTTTTATAAATGTTCATGCAATTT
AAAAAAGTATTCTGAATATGAACTAATATCTGTATTATCT
TTAGTATATTACAACCAATTACCGCTGATCAAATATATTT
CAGGCTGTATATATATAAATATATATTAAAAAAAGACTAG
AAACTAACATTTATCAGTGTTTACAGAATTGTAGAGAATT
GAAAGTGTTTACAAATTTCACATCTAAATTTGAATGATTG
TGTAGTACACTTTATATATTTTATTTTGAAGAATTATCAT
TCCTGTCCGTCTTTTTTTTTCTATAATCCATTTTGTATTT
TACTAAATACATTGTGGCAATCATCTCAGAGGACTGTGAT
CACATGGTGCTTGGGAAATGGCTGTATTTTACATTTATGC
TGGGGTTTTGACTGCATTGATAGTCAGTGAATGAAAGGCA
TACCCTTCGTAATAAATCCACAGCTATGGAAAAACCAATT
GAGACCACTTGAAAATGATCTGGATTTATGATTTATATTT
ACTATATAAACTTCTCATGACCTTTATTCCAATTAAATGC
ATTCATTTAGAGAATTTTGTATGCAACAAAAGTGTGCCAT
GTTTCTTGACGTTTTTATTTATGATTAGAAATCAATACCA
ACCTCGAAGGAATTAAGAAGTCATTATTTGGTGAGATAAC
TCCTGAATTCCATTAAAACATTAACATCATAACTGTCATT
ATCTGATGAAAAACAAAATGCTTCAAGTGACAATATTTCA
GAAATACATTTGGAAGTTTTATCAGACGTTTATAGACTTA
AACAAATGTTTACTCAAACCCATACCTATTAAATCCAGTA
AATCCACTGAATAATCTCAGGTGGTCTCTGAACTTTTTCC
GTAGCCGTTCGGTTCCTCCCATGTGCAGAATGTTTAATGG
TTGAATGATTGTTTTTCAACTGACGACTATAATTTGTGAT
CGCCATGTTCATTATTTTGACCAGCATCATCATTTAGGAT
GAAAAGGGCAAACTGTCTTCACTCCTAAAGCTTGTACGTC
TGTCATAATGCTTATCAATATGATTTATTTTTGAAATCAT
CTCTTCAAATGGAAGATAGAGCCTTCTGGGTTTCAATAAA
TTTAGGTGCCAAACAACGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snx17-201 Contained in:
OTHER snx17-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039416 (1)
  • Ensembl_Trans:ENSDART00000040191 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162993 (1) 3446bp
    GenBank:AW422528 (1) 658bp
    GenBank:CD595960 (1) 650bp
    GenBank:AW420111 (1) 640bp
    GenBank:AI722949 (1) 459bp
    GenBank:CD586660 (1) 316bp
    CITATIONS (2)