header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19587
Transcript Name: larp4b-201
Previous Names: larp4b-001, zgc:153918-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039287 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039287|OTTDARG00000028738|ZDB-GENE-061027-39 larp4b|OTTDARP00000031432 CH211-197K23.2-001 LG_ CR376848.7 Danio rerio protein_coding KNOWN, 2773 bp
CGGCTCAGGGCGGGAGTTCGCGGTGCGGTTTGGCCGAGAG
AGAGAAGCTCAACTCCGGACACAAATACACGGGGAGGGAA
GAGTCGTGTGGTTCCGTTCATTATCATATCCCAGTTTAAC
TAGCACGTACAGTTACAGTTAACGTCGTTCGCGTTTCTCG
CACTGTGATTCAATCCGTTTTGAAGAATAACACACATTCA
CTCTCGTCTCGTGTCGTTTACGTTACCATTTCGACAACAA
ACGTTAGCCAGTCACTTAAACATCACCAAACAGACCTTTA
AAGTTCACTATCAGGCCTGATTCCAGGGAGCTGGTGAAAA
TCGGAGGCTGTTAAACGTTGTGTGGTGCTTTAAAAGTTTC
CTGCACGGATTTGTGGGTTTGTTTTTCTAAGTTTTGTCCG
TGGAAGTCTGACGTTCAGGCCCGCAAGCAGTCTCCCGTAC
GCGGAGAGCAGATACAGTTCCCTGGTGGTCTGGAGAGCTC
TGCGTTTGGAGCTAGAACCTGGACAGCTCATGACTTCAGA
CCAGGAAGGAAAAACTATCGTGGAGCCACAGGTGCAGCAG
TCACAGGAAGCAAAGGAGAAAGAGATTCCCCTTTTGGAAT
CGTCCAAGATCTCAGACCTCAATCCCAATGCGAAGGCATG
GGCCAATTACATGCCTAAACCGGAGGCTTCTGCTCCAACC
TGCCCTGACTCTCAGCAGTCATGGGTAGAAGCGGCCGATG
ACCCATCTAACTGCATCTCAGATGGATATAACAACAGTGA
AGACAAAGGGAACTGGAATGAGGAACAGCAGGTGTCTACC
TCTGTAGAATTGCCCTTTGCAGCACAGCCAGAATCAGTGT
ACTTGGGAAGCTCAGTCATTGAGAAGGGCATTGTGTCAAA
CCAGAACACCAGTATGAAAGGGGTGGATGATTCAGACTCC
TCCAGACAACTTGAAGACCTTCGGGAACAGTTGAAGGCAA
CACTGGAGTTCTGCCTCTCTAGGGAGAATCTCGCTAATGA
CATGTACCTCATCTCGCAAATGGACAGTGACCAGTATGTG
CCAATAGTGACTTTGGCAAACCTTGATCAAATCAAAAAAC
TCACCACCGATGTGGATCTCATTTCAGATATCTTAAAAAC
GCTGCCTCTTGTCCAAGTGGACAAATGTGGAGAGAAAGTG
CGGCCCAATCAGAACCGCTGCATCGTTATTCTCAGAGAGA
TTCCCGAGGCCACTCCTCTGGAGGAAGTTGAAGCGCTCTT
CAAGAGTGATAACTTGCCCAAATTCATCAATTGTGAGTTT
GCCTACAACGACAACTGGTTCATCACCTTTGAATCCGAGG
CAGATGCTCAGCTGGCATATCAATATCTCAGAGAAGAGGT
GAAAACTTTTCAAGGAAAGCCAATAAAGGCTAGAATAAAG
GCCAAGGCCATTGCCGTCAATACCTTTGTGCCAAAAAATG
GATATCGGCCAGTAGATGTGTCCTCAAATGTCCAACAGCG
CTACACACCTTACTACATCCCACCTGTGTATGGAGCACAG
CAACAGTTTCCTCTTTACAGACTGGTGACGCCTCAGGGCT
GGTCAGCTACTCAGAGCTACCTGGACCCAACTCTGGTTTC
TCCATTTCCCAGCCCTGCATTTATTAATGGCTTCGCTGGT
TCTCCGACATTTAAATCTGCGACATCTCCACTAACTGTCA
GACATTATACACATGCACCTCGAAACAGGAACCACAACAA
AACTCACATTCGACTCCCAACAGACCGTGGAACCACTTTA
CTGGAAAACCCTGCTGCTTTCTCGACTTTCCCTACAGAAA
GAATTCCCAACGGGACGCGTCCTCCACAGACTCATCACTT
GGGTAGCAGACCTCGACTACCGACTGGTCTGGCATATCCA
CGCCGGGACCAGGTAGGAAGTGGACGGATGGAAGTAAATG
GGGCCGATTACTCTCTAAACGCGGGTCGTGGAAGGGGCGG
CTTTGGATACCGGAAACGGAGAGATGACAACAAATTTCCA
AGATCAGGAACACAGTCGCCCCCTCCTGTTCAGGAGCGCA
CTCCTTCCCCCAGTTTTGAACTGGGCTTGTCAAGCTTCCC
TCCTCTGCCAGGAGCCGCAGGAAATCTGAAGCCTGAAGTA
AAACCTGAAAACAGCCTTGACAACCGGCTGTCTGACGTTG
TTATCGGAGCAGTAAAAGACAAGCCTCTAAATAAGGATGT
GGTCACCAGCCGTGTGATCTCAGGGACCCCCAAAGAATCT
GTTCAGGCTGCTCCGGCTCCTGCTGCTCAAACCCCAGTGG
ACCACCAACACTCACCCTCTCCCGCCCAAACAAGCCCGAC
AGCTGTAGAAAAACCTAAAGAGACACAGACACCTGCAGAA
AAATGCTCAGACACACACGCTGCTAAAACCACACCACTGA
GCAATCCAGTGACGCAGGAGCCCCGGAAGCCAAGCTACGC
AGAGATCTGTCAGAGGATAAGAGAAGCACCAACACAGCAG
CCGTCAGCGGATCCTCGAGCTCCCAGCTCCACCGCCGAAG
ACGTCAAAACTCCTGACTCTGCAGAACGCAGATGCAAAGA
ATCAGCGTCCGCACCTGCCAAATCCACAGCCACAGCGTGT
CCCAGAGAGACAGTGAAATCTCAGCAGAGTCCTGGAGATC
GAGCGACCGCTGGCACCACAGCTTCCTTCCACCAATCCTG
AGAGCCTCTGCTTTGCTTCCAGGACCGAGCGGGAATGAAA
ACTCTGTCAGGGCTGCTCCCCCCCGCAAAAAAAATTAAAA
AAGAAGAAGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
larp4b-201 Contained in:
OTHER larp4b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039287 (1)
  • Ensembl_Trans:ENSDART00000089506 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC134834 (1) 2573bp
    GenBank:BC124489 (1) 2565bp
    GenBank:DN832695 (1) 745bp
    CITATIONS (2)