header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19583
Transcript Name: gp1bb-201
Previous Names: gp1bb-002, si:dkey-285c2.8-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039282 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039282|OTTDARG00000028734|ZDB-GENE-081104-406 gp1bb|OTTDARP00000031428 DKEY-285C2.8-002 LG_ CU469504.8 Danio rerio protein_coding KNOWN, 874 bp
AGTCTTAACTCTCCCTCAGGCTGATACTGACACACAGACT
TTACTAGCGCTGTGACCGGTGTTGTGTGTTTCTTCAGTGT
GTGTGTGTGTGTGTGCTGGTATGAGGAGTGTTGTGCTGGT
GTTTTTCCTCAGTGCGATGGCTGCAGTGGTTCAGGGCTCG
TGTCCTCATGTGTGTTCGTGCTCTGCTGGTGTTGTGGACT
GCAGTAATCGTGCTCTCACCACCGCCACGCTACCCTCGTC
CTTTCCAGCGTCCACCACTGAGCTCCTGCTAAATGAAAAC
CACCTAACGGCTCTGCCCACCGGCCTGCTGGACGCTCTGC
CCGCCCTGCGCCGCGTCGCCCTGCACGGAAACTCCTGGGC
CTGCGACTGCGCCATTCTTTACCTGAGGGGCTGGATGCTG
AAACGTGGCAGCGACCCGTCTATGCGGAACGTGTCGTGCA
GTTCTCCTGCTCACCTGCGGGGGCGCCTGATCGTGTATCT
GCCGGAGCAGGAGCTGCTGGACTCGTGTCGGTACTGGCTG
TGTAATTTAGCTCTGGCGTCTCAGATCAGCCTGTTGGTCT
TCATTGGCGTTCAGGCGCTCCTGTTGGCTTCCGTCATCTT
CTTCCTACGCCGGTTTGAGCGGCTCACCGAGGAGGCACAG
CGTACAGCAGCCGAGAGCTTCACGGCAGAGGAAAACGCGG
ATCACAATAGCGAATACGTCATGCTGAAGGACAGGAGCAT
GTAGAGCTGCGGTCACTGCGTATCGCATATAATTATAATA
ATGTATAAGTGTCCATTTTACATTCATTTCCTTTTTATTG
CATGATACTTTTCCAAAATACTTAGAGTTGTAAGTTAAAG
GGATAGTTCACCCAAAATTAAAGTACAAATCAAA

gp1bb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gp1bb-201 874
gp1bb-202 (1) 2349
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gp1bb-201 Contained in:

OTHER gp1bb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039282 (1)
  • Ensembl_Trans:ENSDART00000134324 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH490193 (1) 903bp
    CITATIONS (2)