header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19482
Transcript Name: gbx1-201
Previous Name: gbx1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039178 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039178|OTTDARG00000028677|ZDB-GENE-020117-2 gbx1|OTTDARP00000031352 gbx1-001 LG_ CT583690.12 Danio rerio protein_coding KNOWN, 1824 bp
GCTCCAGACAAAAAACGCATCAGGTCTCAGTCAGTTGGAC
GGCGAGGACCCTACAGCAGCGCCAGGATAACCGTGGACAC
ACATTTGGGTGATTTGAAGGCCAGTACAGCACGGGATTTA
TACGACCAGACCGCGCTCAGTTCACCATGCAGAGACCGAG
CGGTACGGGCACGGCGTTTTCCATTGATTCTTTGATTGGC
ACTCCACAGCCACGACCGGGCCACCTGCTCTACACGGGCT
ACCCGATGTTTATGCCGTACCGACCGCTTATGATTCCACA
AGCCCTGTCTCATTCGTCATTACCGTCAGGGATCCCACCT
TTGGCACCGCTGGCATCTTTCGCAGGGCGTCTGACCAACA
CTTTTTGCGCGGGGTTAGGACAGGGAATGCCCTCCATGGT
GGCGCTCACCACCACCCTGCCTAGTTTCTCGGACCCTCCA
GATAGTTTCTACCCCCCGCAGGAGATGCCGGGACCCCGGT
TAGGCGCAGACGGGACGGGGATGAACCGGCAAGAGAGCCC
GCATGACGAACTCAAAGGCTCCGAACTCCTCAATTTCACG
GAAACTTTTCAAGCAGTTGCAGGCGAAACCAAACTCTACA
GTTCAGATGACGAGAAACTGGACCTGAAAGCAGCGGAGGC
CGCGTGCAGTGACCGGGAGGACAGCTCGGCCGACAGCGAG
AACGAAAGCTTCTCCGACGGAAACACCTGCGCCTCTGCGT
CCCAGAAAGGCAAACTGAAAGGCGGCTCACAGGACGCGTT
ACCGCCGGGCGGCTCTGCGGGAAAGAGCCGCAGGAGACGG
ACAGCTTTCACGAGCGAGCAGCTGCTGGAACTCGAGAAGG
AGTTTCACTGTAAGAAGTATCTGTCCCTCACCGAGCGCTC
GCAGATCGCGCATGCGCTCAAACTCAGCGAGGTCCAGGTC
AAAATCTGGTTCCAGAACCGCAGGGCCAAATGGAAACGGA
TCAAAGCCGGAAATGTCAACAACAGATCAGGCGAGCCCGT
CCGGAACCCCAAAATCGTGGTGCCCATTCCAGTGCACGTC
AACAGGTTCGCGGTGCGGAGTCAACATCAACAGATCGAAC
CGGGCAGCAGGCCATGAATGAACTCCTCAATATAAATGAC
TCCTCAAGTGAACATTTACTTGACCTCGTTTCACTGGTCA
GGGGCCACAGATGCATGAAGCACAGCTCAAAGGAGACAAT
TAGGATACTTCTTTAGGTAACAATAAAATACACGAGGCCT
ACTTAATGCTTAACGGATTATCTGTTTATATTTATTCGAT
TCTAAATAACATATATATATATATATCAAAGTTTATAATA
TTTGAATGTATATTAACATGTAACCTGTTAAGCATTTACA
CATGGACGTTATTTGAAAGTGTTACCGACTTTTATATCTG
TTCATTTCGACATTGCTTTCAGGTTTGTTCAAATTCCTTT
ATTTTTAATTTATTATTTTGTACATTTTGTAAATATGAAA
TGTGTCCGCGCGACACACATGTGCACTATACGAGACTGTA
AAGAGACTTTTTAAAAGAATAATAAGTATTTATAAGTTGC
TGTCTAGTGAATTTTTGCATGTGTTTTGCCATTTGTTGTC
TGATTTCCCCGTGTTGTTTTAACGGGCCGTTCTCGTTGTT
TCGACCTTTTTTGCATGTGCTCTTAAAGCATTTCTGTCCC
TCAGAGGCGGAATCTCCCCCAGTTCTTTGTGGAAAAAACG
GTGATGGAAATAAATAAGCTGAAGAACACAATGGCAGACT
GATATATTCCAATCGACCTCACAATAAATATGGTGCAATA
TGTTTGCATAAAACTGTTCAGGGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gbx1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000039178 (1),  Ensembl_Trans:ENSDART00000105572 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF288763 (1) 1836 bp
CITATIONS (2)