Transcript

oard1-201

ID
ZDB-TSCRIPT-090929-19253
Name
oard1-201
Previous Names
  • oard1-001
  • zgc:110708-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038926 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038926|OTTDARG00000028535|ZDB-GENE-050522-480 oard1|OTTDARP00000031152 DKEY-109J17.2-001 LG_ CR388168.14 Danio rerio protein_coding KNOWN, 2633 bp
TCCAATTCGAAAGTGAAGCGAATGCGCGTTTTCCTGTGTT
TTTCTACGGACACTTTATTTGCAGAAATTGATTTACGTGA
ATGTTTAAAGGAACGCAAAACCAAACATTCATCGCCATTG
TTTGAAAATCATACCAACAGTCGAGTCCCTTCTTAAATCT
CAGAGGAATCTAATGGACAAGTTCGTATCAAGGAAGGCCT
CGTTCAGCTCAGGCTGGCAACTGCTCCACAGGAGAGGTGA
TCTGTTCACCTGTCCACCCACCGATGCCCTGGCGCACTGC
ATCAGTGAGGACTGCCGGATGGGAGCCGGGATCGCTGTAC
TCTTCAAGAAGCACTTTAAGGGAGTTGAAGAGCTCAAGGC
ACAGAAGAGGCAACCTGGGCAGTGTGCTGTTCTTGAACGA
TCTGGTCGTTTTGTGTACTACCTGGTCACAAAGAAGTACT
ATTACCAAAAGCCCACAAGTGAGAGTCTCCGAAAGAGCCT
CATGTCTATGAAGGAACACTGCTTAGCTAATGGCGTCAAC
CGAGTATCCATGCCTCGTATTGGCTGTGGTCTGGATAAAA
TGCATTGGGAAAATGTGTCTTCCATCATCACAGAAGTCTT
CCAGGACACTAAAATCTCCATCACAGTGTACACAATCTAG
ACCCCAGTAGGTCTAAAACTCAGGGTATTTCTTTTCTGTT
CTTACAGAATGGTCAGGGGGTTGCTTTTTGTTCCCATGGA
ATTTCACAACTTAATACTTATTGTATGTAGGGTGTTCGAT
TATCTTCTGGGGAAATGAAAGCTCTTAAAATGTTTGAAAT
CATACAGACTGTTCCTGTTATATACTCTTAATATTCTGCA
ACTGATGTTTTGTCACCACTAGAGGGCGATGTTGCATAGG
TATAGTTCAATCTCAGAGATTATTTGATAAGTGACGCTTT
CAGTAATCAGTAAGTGTATGAAAAATAGAAGTGCACTAAA
TGAGCTATAAAAAAATAATTTCATCATTCTTTTGTTATTC
TCATTCACAGATGATTATGTAGTGGTCCTCAAACCTGTTT
CTGTAGCTTTACCTGAATTTGAAATTAGCTGAATATCTTT
TTATAGCAGAAAAAGTAAGAGTGCTATTTGAGTATGTGCT
TCAGAACTCAGCATGTGTCTCGTTTTGAAGGCTGCACCCT
CTGAAGGTCGCATTAGTCAACTGCATGCGTCAGCCAGGCT
CTCTTATTTCAGAGAAGAAAGCACCCATTATAACATTGAC
TGTTATTCCTCATGAGGCATAATTACTGTCATTTCTGTCT
TTGGAAACAAATGTGACCTCCTGAGGGTGTAGCCTTCAAA
ATGAGACACCGCTAACATCATACATATCATAGCGCTGTCT
GCTTCTTGCTTGTGACAGGAAACCGTCTCGAGTTTATTTT
ATTAACATACAAGGATTTGCATACAAGGATATTTTTTAAA
AATCATTTCTAAAATACATTTAAACATGATGCTTGAAGCA
ATGAAAACTATAGTTTAATTAGATGCACTGTGAATTATAT
GACAAATAATACATTTAATGTTTTTTTTTTATTATTACAT
GTTTGGCTAATGTTTTTATGTTAATCAGCAAAATATCAAT
AGGATAGACCATATACTTTAGATGTAAATACTATATGGGT
GTGGTTTAAATTTATTATTTTAAAATTCAATGTCATACAA
GACGTGTAGAGCTGACAAATGCTGCTAAAATTGCTGGATG
ATTGTAATAATTTGCTCTGAAGTACCGAGGCGGTGCCCGG
GCTGTATTAATCTTAATCAGAGGCCAGCTGTTTATACTGT
TAAGAATGCAGGGGTTCCACACAATCGATTTGTGTTGAGA
CAACATGAAGGACTTAAATTAACATGGTAGTTTTTACAAA
TTTAAGTAGATTAAACCTAAAAGAATTAAGTAAAAAATCC
AGAATTGTGTTGATTTAGCTCATTTTAACTAAGTAGTTTG
AACAAACAGCAATTTTTGAGTCTACCCTACTTTAAAATAT
CCTGCAATCTCTCATCATAATACTCAAAGTTATCTTGACA
GTCTTCCCAGGGTGTAAAATTATCTTCTTCGTTCTCAACG
AAAGTAGACCAGACATACACGAAATCCACAGGCCTCATCA
TGCGTAGTTTACACCCTGCCCTAACTAGCGCCTGAAGTCC
GGCCTGTATCTCCGGTTCCTCCCATTCAAAGAGACGGGAG
CAGTGGATATTAAGGCGCAGCGCCTTGCGTGCTTTCAAGA
TCTCCACAAGCTTAGCAGCGCAGGCCACACAAGGGCTGGA
CGATGTGTACCAAGTCACTGTATAGCGGAGGGACTTGTCA
TAATAGGCCAGCACCTGTTGAAAGAAGGCCTCTTCGGCAT
GTGAGCCTGAATGCTCATCCTCCAGGTAACCACGAACGCC
ATCCGTCTCTGCTGCTCCACCTTGTATGTCGACCTGGTAG
CACAGGAAGGTCTTGTTGCGCCCGGACGAGTACTCCACAT
TTTTAAATTGGAACTTGAAGAAGGTTGGGTTTATTCGGTC
TCTGTGGGGAAAAAAGGAATATTACATATAAAAACAACAT
ATAAAAACAAGATAATCACATTGTGTTTTTGGTGCATTTG
GACTGCCATTGGTTGCATTCATATTCAGTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations