header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19056
Transcript Name: cops2-202
Previous Name: cops2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038706 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038706|OTTDARG00000028431|ZDB-GENE-040625-15 cops2|OTTDARP00000031003 cops2-002 LG_ CU372926.7 Danio rerio protein_coding KNOWN, 891 bp
ATTCCCGCCTAGCATTGTGGGTAAGAGTCTCTCTCTCCGG
TCAAAATGTCTGACATGGAAGATGATTTCATGTGCGATGA
TGAGGAGGATTATGACTTGGAATATTCTGAGGACAGCAAC
TCTGAACCCAATGTGGATTTGGAGAATCAGTATTACAACT
CCAAAGCCCTCAAAGAAGATGATCCTAAAGCAGCCCTGAG
CAGCTTCCAGAAGGTGCTGGAATTGGAGGGTGAGAAAGGA
GAATGGGGATTCAAAGCACTGAAACAAATGATCAAGATCA
ACTTCAAACTGACTAATTTTCCTGAAATGATGAACCGGTA
CAAACAGCTTTTGACTTATATTAGGAGCGCTGTCACCAGA
AATTATTCTGAGAAATCCATCAACTCCATTTTAGACTATA
TCTCAACCTCCAAACAGGTAATGATGGACTTACTTCAAGA
GTTTTATGAAACCACACTGGAAGCGTTAAAAGATGCCAAA
AATGACAGACTTTGGTTTAAAACTAACACCAAGCTGGGAA
AGTTGTACCTGGAAAGAGAAGAATTTGGAAAACTTCAGAA
GATTCTCAGGCAATTACATCAGTCGTGTCAGACGGATGAC
GGAGAGGATGACTTGAAGAAGGGCACTCAGCTTTTGGAGA
TTTACGCTTTGGAGATCCAGATGTACACGGCACAGAAAAA
CAACAAGAAGCTCAAAGCCCTTTATGAGCAGTCATTACAC
ATCAAATCAGCCATCCCACATCCACTCATCATGGGAGTCA
TCAGAGAGTGCGGCGGTAAAATGCACCTGAGAGAAGGAGA
GTTCGAGAAGGCACATACAGACTTTTTTGAAGCGTTCAAA
AACTACGATGAGTCCGGAAGCCCCAGACGAACCACTTGTC
TGAAGTACCTG

cops2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cops2-201 (1) 2003
cops2-202 891
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cops2-202 Contained in:

OTHER cops2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038706 (1)
  • Ensembl_Trans:ENSDART00000133872 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EG569065 (1) 906 bp
    GenBank:CD759502 (1) 866 bp
    GenBank:BQ284124 (1) 525 bp
    CITATIONS (2)