header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19055
Transcript Name: cops2-201
Previous Name: cops2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038705 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038705|OTTDARG00000028431|ZDB-GENE-040625-15 cops2|OTTDARP00000031002 cops2-001 LG_ CU372926.7 Danio rerio protein_coding KNOWN, 2003 bp
GGCGGGAACGGGCTTCCATACATTCCCGCCTAGCATTGTG
GGTAAGAGTCTCTCTCTCCGGTCAAAATGTCTGACATGGA
AGATGATTTCATGTGCGATGATGAGGAGGATTATGACTTG
GAATATTCTGAGGACAGCAACTCTGAACCCAATGTGGATT
TGGAGAATCAGTATTACAACTCCAAAGCCCTCAAAGAAGA
TGATCCTAAAGCAGCCCTGAGCAGCTTCCAGAAGGTGCTG
GAATTGGAGGGTGAGAAAGGAGAATGGGGATTCAAAGCAC
TGAAACAAATGATCAAGATCAACTTCAAACTGACTAATTT
TCCTGAAATGATGAACCGGTACAAACAGCTTTTGACTTAT
ATTAGGAGCGCTGTCACCAGAAATTATTCTGAGAAATCCA
TCAACTCCATTTTAGACTATATCTCAACCTCCAAACAGAT
GGACTTACTTCAAGAGTTTTATGAAACCACACTGGAAGCG
TTAAAAGATGCCAAAAATGACAGACTTTGGTTTAAAACTA
ACACCAAGCTGGGAAAGTTGTACCTGGAAAGAGAAGAATT
TGGAAAACTTCAGAAGATTCTCAGGCAATTACATCAGTCG
TGTCAGACGGATGACGGAGAGGATGACTTGAAGAAGGGCA
CTCAGCTTTTGGAGATTTACGCTTTGGAGATCCAGATGTA
CACGGCACAGAAAAACAACAAGAAGCTCAAAGCCCTTTAT
GAGCAGTCATTACACATCAAATCAGCCATCCCACATCCAC
TCATCATGGGAGTCATCAGAGAGTGCGGCGGTAAAATGCA
CCTGAGAGAAGGAGAGTTCGAGAAGGCACATACAGACTTT
TTTGAAGCGTTCAAAAACTACGATGAGTCCGGAAGCCCCA
GACGAACCACTTGTCTGAAGTACCTGGTCCTGGCCAACAT
GCTGATGAAGTCTGGAATCAACCCGTTTGATTCTCAAGAG
GCGAAACCTTACAAAAATGACCCAGAAATTCTAGCAATGA
CAAACCTGGTAAGTGCCTACCAGAACAATGACATCACAGA
ATTTGAGAAAATCCTCAAGACGAATCACAGCAACATAATG
GACGACCCCTTCATCAGAGAACACATTGAGGAGTTGTTAA
GAAACATAAGAACACAAGTGCTCATCAAACTGATTAAGCC
TTACACTAGGATACACATACCATTTATTTCAAAGGAATTG
AATATCGATGTCGCAGATGTGGAAAGCTTGCTTGTGCAGT
GTATTTTAGACAACACAATCAATGGTAGAATTGACCAAGT
CAATCAGCTGTTGGAGCTCGATCACCAGAAAAGAGGCGGA
GCCCGATACACGGCTCTGGACAAATGGACCAATCAGCTGA
ACTCTCTCAATCAGGCCATAGTCAGCAAACTGGCTTGATT
TCGACACCGAAGATCCTGGGGGAAAAACAACAACAAACAA
ACTCACCCATCGGGCAACCGGACAAGCGCAGGCTGTCAGT
GACGTTAACTTACTCTCAAGCCCTTTACTCCTGCCATCAC
ACAATCGCATGATGGGGGAGCGTCGTTTGGCTAGTTTGTA
CTTTTACAGCTGTAGTCCATTTTAAATGTCCTTAACACAA
AAAAGCGGAGGTTCCCACTGGATGTCTGCTCTACTGAATT
GTTAGGTCTCTAATATGAATATGTTTGCATTACCTGGAAA
ATAAAAGTTACTTTAATTGCACATATTGGCACTTGGCAGA
CATTGATAAGGCAAATGTTTGTCTTTATTGAGGACGGGTT
TGTGAAAATGAATCATTTTATTTGTTGAACTATCTCTTGT
CAGAGTCAGCATGTTTTATTTGGTTCGCATAAAGCTCAGC
TGATGGGTTTTGATGTCACCGCGCTACATGCGTACGCAGG
AGTAGCTAAAGTGCGGTCATTGCTCGATTTTTCTCTCACT
GAACATTACAGATATGTTCAATCGTAATGCTGTTCTGTTT
CACTTTTCAACAGTAAAATAAAGATGCATTTGTTGCTTCA
GCA

cops2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cops2-201 2003
cops2-202 (1) 891
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cops2-201 Contained in:

OTHER cops2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038705 (1)
  • Ensembl_Trans:ENSDART00000006124 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071320 (1) 1998 bp
    GenBank:CK676720 (1) 412 bp
    CITATIONS (2)