header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19027
Transcript Name: cpa5-201
Previous Name: cpa5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038677 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038677|OTTDARG00000028416|ZDB-GENE-020514-1 cpa5|OTTDARP00000030982 cpa5-001 LG_ CT573397.14 Danio rerio protein_coding KNOWN, 1353 bp
CGAGAAAGCTCTACTCGAGCAAGATGAAGAGGCTGCTGGT
GCTGATCGCTCTGTTTGTGGCCGTCTTTGGCAAAAAGACC
TTTGAGGGGGATCAGGTGTTTCGGATCACTCCAAAAGATG
AAGCTCAGATTGACCTCCTGAAGGAGCTCACTGAAGAGGG
CGAACATCTTGGCCTTAGTGTCTGGATGGAGCCCATTCTT
GAGTCTCTGCCTCTGGATCTTCATGTCCCCTTTCACAGTC
TCCAGGCTGTCAGGGCGTTTCTGGCCTACAATCAGATCCC
ATACCACATCATGATCGAGAATGTCCAGGAACTGTTGGAT
GATGAGCAACGTGATATGGTGAAATATCGTGGCCTTGCAA
GATCTACAGATGACTTTGTGTACACCACCTACCATGACCT
GAACTCTATCAACTCATTCATGGACATGCTTGTCGCAGAG
AACAGGAACATGGTCAGCAAAGTTGTGATTGGTCAGAGCT
ACGAGAAACGCCCCTTGAATGTCCTGAAGTTCAGCACTGG
AGCAAACCGTCCTGGTATCTGGATCGACACTGGTATCCAC
TCCAGAGAATGGGTCACCCAGGCTAGTGGAGTCTGGTTTG
CCAAGAAGATCGTGAAAGACTATGGACGTGACCCCGTCCT
CACTGACATCTTGAACAGCCATGATATCTTCCTGGAGATT
GTCACCAACCCTGACGGTTTCGTCTACACCCACACCAAAG
ACCGCATGTGGCGTAAAACCAGAAAGCCAAACCCTGGCTC
CAGCTGCGTTGGAGTTGATCCCAACAGGAACTGGGATGCT
GGTTTTGGAGGTGGTGGTTCCAGCAACAACCCCTGCACTG
AAACCTACCGCGGCCCCAGTGCTCACTCTGAGCCCGAGGT
GAAGGCCATTGTGGACTTTGTGAAGTCTCACGGCAAAATC
AAGGCCTTTGTGTCTATCCACAGCTATTCCCAGATGCTCC
TCTACCCATACGGATACACATATACCGCCGCCAAGGACAA
GGCTGAACTGCATGAGGTCGCCAGGAAGGCCATCACTTCA
CTGCAGTCATTGTACAACACTCGCTACACCTATGGAAGCA
TCATTACCACCATCTATCAAGCCAGTGGAGGCACTATTGA
CTGGACCTACAACCAGGGCATCAAGTACTCCTACACCTTT
GAGCTGAGAGACACCGGTCGCTATGGTTTTATTCTGCCAG
CCAATCAAATCGTCCCAACCGCCGAGGAGACCTGGCTCGC
TCTGATGGCCATCATGGAGCACACCAAGAATAACCCTTAT
TAAACGTATAGCAACATTTCAGACGGAAAGTGTATAAAAG
AGAGTTAATAAAAAAAAGAACAAGACAAAGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cpa5-201 Contained in:
OTHER cpa5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038677 (1)
  • Ensembl_Trans:ENSDART00000034377 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065991 (1) 1363bp
    GenBank:BC056300 (1) 1360bp
    CITATIONS (2)