ZFIN ID: ZDB-TSCRIPT-090929-18912
Transcript Name: sept8a-202
Previous Name: sept8a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038534 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038534|OTTDARG00000028342|ZDB-GENE-030131-309 sept8a|OTTDARP00000030881 sept8a-002 LG_ AL954767.11 Danio rerio protein_coding KNOWN, 756 bp
AATTCTCCAGCCACAGTGAGCGAGTGTGTGTATGTGTGGA
CGAATGAAGAAAAGCGTAACCTCAGCCTCGGCGGTCATGT
TGGCTTTGACAGTCTGCCCGATCAGCTGGTCAGTAAATCG
GTGACTCAGGGTTTCTGCTTCAACATCCTCTGTGTGGGTG
AGACGGGCATCGGCAAGTCTACATTAATGAACACGCTTTT
TAACACCATGTTTGAAAACGAGGAGGCCAGCCATTACCAA
AACGGCGTCTACCTGCGGCCCAGAACGTACGACTTGCAAG
AGAGCAACGTCCACCTGAAGCTGACTATCGTCGACACAGT
GGGCTTTGGGGACCAAATCAACAAAGAAGAAAGCTATAAA
CCCATTGTGGACTATATCGACACACAGTTTGAAAACTACC
TGCAGGAAGAGCTGAAAATAAAGCGTTCTCTCTTCAACTA
CCACGACACCAGAATCCACATCTGCCTCTACTTCATCTCT
CCGACGGGACACTCGCTCAAATCCCTGGATTTAGTCACTA
TGAAGAAGCTGGACAGCAAGGTGAACATCATACCCATTAT
CGCCAAAGCTGACACGATTTCCAAGAGCGAGCTGCACAAG
TTCAAGATCAAGATCATGAGCGAGCTGGTCAGCAACGGCG
TTCAGATCTACCAGTTTCCCACAGACGATGAAGCCGTCAC
AGAAATCAACTCCTCTATGAACGCCCATCTACCGTTTGCT
GTGGTGGGGAGTGTTGAGGAGGTGAAGGTGGGCAAT

sept8a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sept8a-201 (1) 2021
sept8a-202 756
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sept8a-202 Contained in:
OTHER sept8a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038534 (1)
  • Ensembl_Trans:ENSDART00000139668 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT864186 (1) 769bp
    CITATIONS (2)