ZFIN ID: ZDB-TSCRIPT-090929-18911
Transcript Name: sept8a-201
Previous Name: sept8a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038533 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038533|OTTDARG00000028342|ZDB-GENE-030131-309 sept8a|OTTDARP00000030880 sept8a-001 LG_ AL954767.11 Danio rerio protein_coding KNOWN, 2021 bp
TTCGCCATAGTAACGTTCGTAAATTCTCCAGCCACAGTGA
GCGAGTGTGTGTATGTGTGGACGGTGAGTGAAACGAAGGC
AGCTCCCTTTCGCCTTATAAAAACACATACATTCCTCATC
ATGGCGGCCACGGATGTAGACATATTTTCTAATGAAGAAA
AGCGTAACCTCAGCCTCGGCGGTCATGTTGGCTTTGACAG
TCTGCCCGATCAGCTGGTCAGTAAATCGGTGACTCAGGGT
TTCTGCTTCAACATCCTCTGTGTGGGTGAGACGGGCATCG
GCAAGTCTACATTAATGAACACGCTTTTTAACACCATGTT
TGAAAACGAGGAGGCCAGCCATTACCAAAACGGCGTCTAC
CTGCGGCCCAGAACGTACGACTTGCAAGAGAGCAACGTCC
ACCTGAAGCTGACTATCGTCGACACAGTGGGCTTTGGGGA
CCAAATCAACAAAGAAGAAAGCTATAAACCCATTGTGGAC
TATATCGACACACAGTTTGAAAACTACCTGCAGGAAGAGC
TGAAAATAAAGCGTTCTCTCTTCAACTACCACGACACCAG
AATCCACATCTGCCTCTACTTCATCTCTCCGACGGGACAC
TCGCTCAAATCCCTGGATTTAGTCACTATGAAGAAGCTGG
ACAGCAAGGTGAACATCATACCCATTATCGCCAAAGCTGA
CACGATTTCCAAGAGCGAGCTGCACAAGTTCAAGATCAAG
ATCATGAGCGAGCTGGTCAGCAACGGCGTTCAGATCTACC
AGTTTCCCACAGACGATGAAGCCGTCACAGAAATCAACTC
CTCTATGAACGCCCATCTACCGTTTGCTGTGGTGGGGAGT
GTTGAGGAGGTGAAGGTGGGCAATAAGACAGTGAGGGCCA
GGCAGTACCCATGGGGCGTCGTTCAAGTGGAGAACGAGAG
TCACTGTGATTTCGTGAAGCTGAGGGAGATGTTGATCCGG
GTGAACATGGAAGATCTGAGAGAGCAGACTCACGCCAGAC
ACTACGAGCTCTACAGGCGCTGTAAACTGGAGGAAATGGG
CTTCAAAGACACCGACCCTGACAGCCAGCCCTTCAGTCTG
CAGGAGACGTATGAAGCCAAGAGGAAGGAGTTTCTCGGAG
ACCTGCAGAAGAAGGAGGAGGAGATGAGGCAGATGTTCGT
CAATAAAGTGAAGGAGACGGAGGCCGAGCTGAAGGAGAAG
GAGAGAGAGTTACATGAGAAGTTCGAGCAGCTGAAGCGAA
TGCACCAGGAGGAGAAGAGGAAAGTGGAGGAGAAGAGACG
CGAGCTGGAGGAGGAGATGAACGCTTTCAATAGGAGGAAA
GTGGCCGCCGAGACCCTCTCGCTCTCACAGCCCCTCAAGA
AGGACAAGGACAAGAAAAATTAATTTATGAGCACATCGCA
GGCCATCCATGGACTTTCCTTCATTACATTTGCAGCGTCG
CCTTTTGATTTGTTTAGTTTTTTTGACATGTTCCTTGTGT
TAAAGGACCAAAAGCTCCTGATTGGACGGCAGAGAGGTGC
ATTATGGGGACTGAACAGATTCCTGTGTTGTATTTTTGTC
TCTTGTTTTCCTTCATGTGTGTTTCTGGTGTGGATGAAGG
TCATTTTTAACATCCCTCATCAGCTGTGTTATTTTACTCT
TATGTTTCCGAGCGCGAGTGTGTGTGTTTTCTTTTATAGC
ACACCGTGTGTTTTGGTACTAAACCATCTGCTCATTCGTC
TCGCTGTCAGTTTTTTTTTGTGACGCGTGTATTGAGAAGT
GCACGTTTCCCTTGCCAATGTACAGTAGTATTTAAGATCT
GAGCCAAACTCATGATTACAGCGCAGTGATGATTTTATTA
TTACACCAGCCTGGCCGAATAAAGCTATTTTTGATGCTGT
TTTTAAGAGCACACGACAACAGATATGCAAATGATATCTA
TTTTTTTGTATCGCGAGGTGTATAAGGCTGTATTCAGGTT
ATATTGTTTCACATTTAAAGCCATAGCCGATGCTGAAATA
AACACTCCCCCATTTACATCA

sept8a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sept8a-201 2021
sept8a-202 (1) 756
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sept8a-201 Contained in:
OTHER sept8a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038533 (1)
  • Ensembl_Trans:ENSDART00000109620 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055257 (1) 2062bp
    GenBank:BC151876 (1) 2020bp
    GenBank:BC081662 (1) 2004bp
    GenBank:BC100044 (1) 1985bp
    GenBank:CV485652 (1) 845bp
    CITATIONS (2)