header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1891
Transcript Name: etv2-201
Previous Name: etv2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011104 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011104|OTTDARG00000009676|ZDB-GENE-050622-14 etv2|OTTDARP00000009567 etv2-001 LG_ BX649388.7 Danio rerio protein_coding KNOWN, 1453 bp
CACTGTCAAAACCCCTGATATAGTGAAATAAGGACTCAGT
GAAAACTTTAAGATATGGAAATGTACCAATCTGGATTTTA
CACAGAAGACTTCAGAACTCAGGAGGTTCCTGCTGGTTTC
GACTTCAGTTCATATGACTGCAGTGGTGAAGACCTGTCCT
TTTTATTAGACAGCAAAGGACCCGTCCAACAGCAGTATGC
CGAAAACTACTCCGAGCCTCAGAAGGAGCTGTTGCACAAA
GGTCATGTTCTCACAGTCGACTCTGGGCTGTTCAATCTGG
ACTCTTTCCCTGAGTTCAGCAACTGGGCAGCATACACTAA
TATTCCAGAAGGAATGGTTGCAGACAGACAGCAGGTTGGC
TTTCAGGAATCAACTCAAACCTACCAGAACCTCGTCCCTC
TCTGCACTCCAGCACAAAGCAGTACATTCAGTCCCACAAT
GGACACCAGCAGCCATTACCAACCTGGGAAAGGCCCAAGT
CACAGAGGAGCATCCGGGACCGCCAGCCTTGACCATTTGG
GTGAATCAGACAGGACATATGGTTTGTATGAAGCAGAGCA
GCAAAGCAGGTCTTCATATTGGTCCGACTACCCCTCACCC
GGTTACTGCAGCTCCATGCCGCTTAGCCAGCCTGCATCCT
CCTCATCCCCTCCGGTCAGTCAGTCCGCTGAGCACTTCTG
CCCCCGCGTGGTCAAAAGACGCAGCGCTCCTCCTCAAAGA
TCAGACAGAGAGGGCGAGATCACGCCAATGTCCGCCTACC
CAGGATCTGGACCCATCCAGCTCTGGCAGTTTCTGCTAGA
ACTCCTGCTGGATTCTGCTTGCCACACTTTTATAAGTTGG
ACTGGTGATGGCTGGGAGTTTAAAATGTCAGATCCCGCTG
AGGTGGCGAAGCGGTGGGGCCAGTGTAAAAACAAGCCTAA
AATGAACTATGAGAAGCTCAGTCGTGGCCTGCGTTACTAC
TACCACAAAAACATCATTCACAAAACGGCGGGAAAGCGCT
ACGTCTACCGCTTTGTCTGTGACGTGCAGGGCATGCTTGG
AAAAACTGCACATGAAGTCTTGGCAAGTCTAAACATCTCC
CCGAATGCAGCATCTCCACAGTCTGTAGCAAACACAAGCC
GCTCAGAGGAAACCACAGAGTCCTGGACACATTAGAGGAG
GAATTCTCGAAGGATTGGAAAGAACTTTAAAACATCAGAC
GTCGTGCCTTTGGAGGAACAAAGAACTGACTGACTTGAGA
TTTATGTACTTTAATTTGGACTTTGCAGCAGATTGCCAAC
AACAGATCTGAAGTCAGCTTTGAAATCAAGCTAGGTGCCT
TTAGAAAACCATGTTAGCTACCTCTTTTCACATTGGAACA
TTAATCTTGTAAATGTATTTTGTTTTATCTTATGTAAACT
GATGGTTTGACATCAGATTGTGAACTCTTGTAAATAAATG
TAATATGACAGCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
etv2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000011104 (1),  Ensembl_Trans:ENSDART00000045403 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AI877585 (1) 827 bp
GenBank:AI877726 (1) 407 bp
GenBank:AL915831 (1) 402 bp
CITATIONS (2)