ZFIN ID: ZDB-TSCRIPT-090929-18879
Transcript Name: unc119b-201
Previous Names: unc119.2-001, unc119b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038496 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038496|OTTDARG00000028307|ZDB-GENE-050201-2 unc119b|OTTDARP00000030847 unc119-001 LG_ BX005137.9 Danio rerio protein_coding KNOWN, 2239 bp
AGAGACTCGGACCGAGCGGAGAACAGGAGGATTTAAATAC
CTCTAAAGCGGGCGACCTGCTCAGCCCTTCGGGTGCGGGA
GGGTGACTGTTTTGTGTCTTTGCTAGACCGGGGGAGTAGG
GGGGTGGAGGAGGAGGAACGGATAATGAGCTATTCTTGTA
CCAGCACAGGCAACAGCCAGGACCCATCGAGCTCTAAGAA
GTCCGGCGGCGTTAATCCCGGTAGTTGCAGCAGCAGCAAC
GGAGACACCGGCAACGGCAATAACCGCCACAGCATCCGCG
GCAGCAAGGCGAACTCCAAGCCGGATTCAACCGAGGCCAT
GAAAGTCAAGAAGGGCTGCAACACGACAGACCTCGGGGTC
CCTGTAACCACAGAGGAGGAACTGCTCGCCAACAAAACCA
TCAGTCCGGAGGATGTGCTGGGATTGCAGAAGATCACCGA
AAACTATCTGTGTAGTCCAGAAGACAATTTGTACAATATT
GACTTCACACGGTTCAAGATCAGGGATATGGAGACGGGAA
CAGTCCTGTTCGAGATCACCAAACCACCCTCCACAGATAG
AGGAGATAAAAGAGATGTTGATCCAAACGCTGGACGGTTT
GTACGATATCAATTTACACCAGCTTTCTTACGGCTACGTC
AAGTAGGAGCCACTGTTGAATTCACAGTCGGTGACATCCC
CATCAATAACTTCCGGATGATTGAGAGGCATTATTTCCGC
GAGCAGCTGCTGAAGAGCTTCGACTTTGAGTTTGGCTTCT
GCATCCCGAGCAGCAAGAATACCTGTGAGCACATCTACGA
GTTTCCCCCGCTCTCTGAGGATCTCATTCGTGAGATGATC
CTCCATCCTTACGAGACGCAGTCCGACAGCTTCTACTTTG
TGGACAACAAGCTGGTCATGCACAACAAAGCTGATTATTC
GTACAGCGGAGGCCCTTAGGACAGCAGTGGGCGGGACTAA
GGCAGAGTTTGACTGACAGACCTAAGAACCAATCACAATA
TCTACGTCCAGCAGCCACGCCCTCTTCAATCAGTGTCACA
GGCGAGCGGCTGCAGTGCGTCATTCCTGTTTTGGAGATCT
AGAGAGTCACACCATAAGGTCTTGTCCGACACGCACACAT
ATCCTATCCTGATTTCACACACTGCCATTCACGTCAGCAA
AAACACAAACTCAAGCATTTATTTTGAAGCGTACCCCAAT
TATGAGCTAACACGTCCCATAGTTTGTATGGGCAAAGCAC
TGTAATGTGAATGGTACTTAGGTTTTACTATTCATTGAGT
GAGTGCGGTGTGTGTGAGATTTGATTCAATGATTGCAAGT
GTGTGTGTGTGAGATGACGCAGATATGACCGTTATATATT
GTTGATGTTGAGTATTTCTTTCCCTGTCAGAATAAGCTAC
ATCAAATTTCATACTTGTGAACTTTTCATCCTAAATAGAA
GCTGATTTTATGGTGAGACCTTGACTTAATTGATAGATTT
GTGTTCATTAGATATATTTTGATACGTGAACAAACTCACT
TACTTCTGAGATGTCGATTATTTGTGTGGAATAAAACAAA
ACTAAAAAAAGAAGCAAAAAAAAACGAATCAAGTGGCATT
CGTGGTGCACATCTGTCAGGGATCTACGGATATTTTTGCA
TTCAAAAGGTTTGCGTGAAGTTCCCGATTATTATACACAA
TTCATGCTGCGAACCAGAGGTTGAGTAGATAAAAAACGTC
TACTGAAAAGGGAACACGGCACACATTACAAGCCTTGACA
TTTCAAACGACTGGCTCCTGTGGTTTCTCTGAAAAAACAA
AACAAAAAGGAAAGGAATATCAGTTTTCAGTAGTTCAGAG
ATGGCGTTTCTCTTCACCTCTCCATCTATCGTTCCCTTTC
TCACACATTCCAGTGATCCAGGCCTCTATCACGCCTGTTT
AGTGCACATAGCTGAGGTTAGATTCAGGATGTGTTGTATC
TATGATCCTTGTTTTCATAGTGCAAAACGTGCATTTACTG
TAGGAGGATGATTTCAATAAACCCTTGTTCTTAAATTGTG
GACATGGAAAAGGGGGTGTAAAGTGGATGGGGAAAAAATC
ATGGACAAATGTTTCTAGTCAGATATGTAACAGCTTTATT
TATGATTGTGATTTACTGTAAATGATTTCGAGGGTGTGAA
AACGAAACCTATGTTTCGGATAGTTCAAACACCAGTCTGG
AATGAAGAGAAATAAATGTATATGTTGAATTTTTGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc119b-201 Contained in:
OTHER unc119b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038496 (1)
  • Ensembl_Trans:ENSDART00000065143 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124479 (1) 2132bp
    GenBank:BC115147 (1) 1580bp
    GenBank:BC129251 (1) 1559bp
    GenBank:BC074025 (1) 1430bp
    GenBank:BC094960 (1) 1360bp
    GenBank:AF387341 (1) 1285bp
    GenBank:DQ650637 (1) 456bp
    CITATIONS (2)