ZFIN ID: ZDB-TSCRIPT-090929-18815
Transcript Name: tnfsf10l3-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038432 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038432|OTTDARG00000028268|ZDB-GENE-070606-1 tnfsf10l3|OTTDARP00000030801 tnfsf10l3-001 LG_ BX511168.5 Danio rerio protein_coding KNOWN, 980 bp
CCGCAGCCCCTCCTCAGCGCGTGCTGGACTCATTCGACAG
GAATGCCGCCGCATCCGAAGGAAACTCGGAATATTTACAA
TCTGTGAGTAGCGAGTCGAGCTCATTCATCATGGTGCAGC
CTAAAAATCGTCTCGAAGTTCCGTCCAAGATGTGGGTGAC
GACGGTTGTGGTCATCGTGATTGTCCTGCAAGTTGCATCG
ACCACCGGACTCTTCATATACTTGAACATGTCAGTGGCAC
AGGCTCGAACACAAGGAATGGTGGAGGAGCTGAGGTGTCT
TGGTCTGCTGAACGCTATGGAGAAAGAGCAAGATGTACCC
GATGATCTAGTCCAGCTCTTTGGAGAGCCGTGCATTAAAC
TAGCAGAAGGACTCAAAGCCTACATCTCTAAGGTCACAGA
AAACATAATCTCCAAACACACCTTTGAAGAAAGAGTTTCT
TTCCCACCAAGGACAAAATTACTCACCACTGGCAGCCCAC
GGCCGTCAGCTCATCTTACTCTCAGAGACAGTGGACTGCA
GGGTACAACATCCCTGACCCCTCAGATGGACCTTCACCAA
TCTTGTCGCCATCCCGTTCGTTCCTGGGGAAACCAGAGCT
TTGGTTCCCACCTGCACAACATGACCGTGTCTAACGGCCG
CCTACGCGTCCCTCGAGCCGGCCGCTACTACCTGTACGCT
CAGGTCTACTTCCGCTATCTGACCCTCTCAGTTGACGATT
ACCACTCAGGCTCCGTCAGCCATCAGGTGGTGCAGTGCGT
CTACAAGAAGACGGCCTACGCTCGCCCTATCCAGCTCCTG
AAGGGTGTGGGGACCAAATGTTGGTCTCCGGACAGTGAGA
ACGCCCTGCACTCCATCTACCAGGGAGGCCTGTTTGAGCT
GCGAGCAGGAGATGAGATCTTCATCTCAGTGTCGTCTCCC
ACAGCTGTGTATGCAGAGGACTCCTCCAGCTACTTCGGGG
CCTTCCTGTTTGACCTCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tnfsf10l3-001 Contained in:
OTHER tnfsf10l3-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038432 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ812113 (1) 870bp
    GenBank:EV558683 (1) 596bp
    CITATIONS (1)