ZFIN ID: ZDB-TSCRIPT-090929-18590
Transcript Name: wnt1-201
Previous Name: wnt1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038199 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038199|OTTDARG00000028143|ZDB-GENE-980526-526 wnt1|OTTDARP00000030615 wnt1-001 LG_ CR352210.11 Danio rerio protein_coding KNOWN, 1360 bp
TGCGTGAATCTGATTTGAGGTTAATTGGTTAACTTTGCCC
TTTCAGATATCATGCGGGTTCTCGCGTTGCTTCTCGCAGT
TAAAGCGGCATGTGTCCTCCTGGTGTCCTCTCTCACTGGC
ACAGGGGCGGTCAACAACAGCGGCCGGTGGTGGGGTATAG
TGAATGTGGCATCCTCGGGCAATCTCCTCACTAACTCTAA
GAATGTGCAGCTGGTACTCGACCCAAGCCTGGCACTGCTA
AGTCGCCGCCAGAGAAAGCTGATCAGGCAAAACCCTGGCA
TCCTTCATGCTATTGCAGCAGGTCTGCACACAGCCATCAA
AGAATGCAAATGGCAGTTTCGTAACCGTCGTTGGAACTGT
CCCACTACCCACAGCCCCAATGTCTTTGGCAAAATTGTCA
ACCGAGGTTGTCGCGAGACTGCGTTTGTGTTTGCCATTAC
AAGTGCTGGTGTTACTCACGCCGTGGCTCGGTCCTGCTCT
GAAGGGGCCATTGAGTCCTGCACCTGTGACTACCGGCGCC
GTGGTCCTGGAGGGCCAGACTGGCACTGGGGAGGCTGCAG
CGACAATGTGGAATTTGGCAGGATGTTTGGACGAGAGTTT
GTGGATTCCAGCGAGAGGGGCAGAGATCTACGCTATCTGA
CCAACCTGCACAACAATGAGGCAGGGCGAATGACTGTCGC
ATCAGAGATGCAGCAGGAGTGCAAGTGTCACGGGATGTCT
GGATCCTGCACTGTGCGAACTTGTTGGATGAGACTTCCCA
GCTTCCGTTTAGTGGGAGATTACCTGAAGGACCGTTTTGA
CGGCGCATCCCGAGTTGTGTATGCCAACAAAGGCAGCAAT
CGCGCATCCCATCGAGCAGATCCCCGACACCTGGAACCAG
AAAACCCAGCGCATAAACTCCCTTCATCTCGGGATCTCGT
CTACTTTGAAAAATCACCTAACTTCTGTTCCTACAATGGC
AAAACTGGAACACACGGCACATCAGGACGTACCTGCAACA
GTTCGTCGCCAGCTCTGGATGGGTGCGAGCTGCTGTGCTG
CGGAAGAGGATACAAGACTCGAATGGAGCAGGTCACCGAA
AGATGCCACTGTACTTTCCACTGGTGCTGCCATGTGAGCT
GCCTCAACTGCACCAGCACACAGACTGTCCATCAGTGTCT
ATGAGGAGAAAACACAACCGACTCACAAACTGGAGGAGAA
GGCTCCCAAATTGGCTATAGAAATGGGCCATTGAGGTGAC
CCTGGGTTCTCAGCTCTTGCCCTGGAGGAGTTTTGTTTGT
CTTTCCTATCTGAAACGCATGCTTCAGTTCATGAAGCTTA
CAGCTAATGTGTTGATGTTCTGAATCCGGGGTGGTAAATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wnt1-201 Contained in:
OTHER wnt1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038199 (1)
  • Ensembl_Trans:ENSDART00000077931 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC163003 (1) 1360bp
    GenBank:BC163014 (1) 1360bp
    CITATIONS (2)