header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18581
Transcript Name: huwe1-202
Previous Names: huwe1-001, si:dkey-242a8.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038190 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038190|OTTDARG00000028138|ZDB-GENE-081104-387 huwe1|OTTDARP00000030609 DKEY-242A8.2-001 LG_ BX664745.13 Danio rerio protein_coding KNOWN, 14397 bp
AAATTAGTGACCATGAAGGTTGACCGAAGCAAATTGAAGA
AAACCCCCACTGAAGCGCCTGCTGACTGCAGGACACTCAT
AGAGAAGCTAAAAGGATGCAGCGACGAACAGCTCTTGCTG
GAACTGCAGCAAATCAAGACCTGGAACATTGGCAAGTGCG
AGTTGTATCATTGGGTGGACTTGCTGGACCGCTTTGATGG
CATCCTCTGTGATGCCGGGCAGACAGTGGAGAACATGTCT
TGGTTGTTGGTGTGCGACCGGCCAGAGAATGGGCAGTTAA
AAGCCTTATTGCTGGCGGTCCTCAACTTCACCGCGTTATT
AATCGAATACAGTTTTTCAAGACACCTGTACAGCTCTATA
GAGCACTTGACCACCCTTCTAGCATCATGTGACATGCAGG
TGGTTCTGTCCGTGCTGAATCTCCTGTATGTGTTTAGCAA
ACGTTCCAACTACATCACCAGACTAGGCTCAGATAAAAGA
AGCCCACTGCTTGCCCGCCTGCAACATCTGGCTGAGAGCT
GGGGAGGGAAAGAGAATGGTTTTGGTCTTGCAGAGTGTTG
CAGAGATCTGCCGATGTCGAAATATCCACCGAGTGCCACC
ACATTGCACTTTGAGTTCTATGCAGAGCCCAGCTCTGAGG
TCAAAGTGGAAAAGAAGTCAAGCAGTAATACGCTACACTA
CATTCATATCGAACAACTTGATAAGATTTCTGAAAGCCCC
TCTGAGATCATGGAGTCTCTAACGGCTATGTACAACATAC
CTAAAGACAAGCAAATATTGCTTTTTACACACATTCGCCT
GGCTCACGGCTTCTCCAACCACAAGAGGAGACTGCAGGCT
GTTCAAGCCAGGCTGCATGCCATCTCCATACTCGTGTACT
CCAACGCCCTCCAGGAGTCAGCCAATAGCATACTCTATAA
TGGGCTTATAGAGGAGCTAGTGGATGTACTTCAGATCACA
GACAAACAGCTGGACATTAAGGCTGCTTCTTTGCGGACGT
TGACATCAATAGTCCACCTGGAACGCACCCCCAAGCTCTC
CAACATCATCGACTGCACAGGAACAGCCTCCTATCATGGA
TTTCTGCCTGTGCTTGTTCGCAACTGCATACAGGCAATGA
TCGACCCACTGATGGAGCCGTACCCCCACCAGTTTGCCAC
AGCCCTCTTCTCCTTCCTCTACCACTTGGCTAGCTATGAC
GCAGGTGGAGAGGCCTTGGTGTCTTGTGGTATGATGGAGG
CATTGCTAAAGGTGATCAAGTTCCTAGGGGACGAGCAGGA
CCAGATTACCTTTGTGACGCGGGCAGTGAGAGTTGTGGAT
CTCATCACCAATCTGGACATGGCCGCTTTTCAGTCCCACG
GCGGCCTCTCAATCTTTATCTGCAGACTGGAGCATGAGGT
TGACCTCTCCAGAAAAGAGTGCCCTTTTGTAATCAAACCA
AAGATCCAGAGGCCCAGCACAGCCACTGAGACAGAGGACA
TGGATACAGATATGGACATGTCCGAGGTTGCCATGGAGAG
CAGTCCTGGACCATCCACTTCTTCTGGCTCCAGAGCAGAG
ACCGATTCGCGAGCACAAAGCAATGCATCCAGCACCCCAA
GAGCAGGAGTGCAGTGCATCCCTCAAAGGGCCGCTCTGTT
GAAATCCATGTTAAACTTTTTGAAAAAAGCCATTCAGGAC
CCTGCTTTCTCTGATGGCATTCGCCATGTAATGGATGGGT
CCCTTCCTACCTCTCTGAAACACATTATCAGTAATGCAGA
GTATTATGGACCATCACTGTTTCTCCTGGCGACGGAGGTG
GTGACCGTGTTTGTGTTCCAGGAGCCCTCTTTACTATCAT
CTCTGCAGGACAATGGTCTCACCGATGTCATGCTACATGC
ACTGCTCATCAAAGACGTCCCTGCCACCAGAGAGGTTCTG
GGTTCTCTGCCTAATGTCTTCAGTGCCCTGTGCTTGAATG
CTCGTGGTCTGCACTCATTTGTGCAGTGCCAGCCCTTTGA
GCGGCTGTTCAAGGTGCTGCTCTCACCAGACTACCTGCCT
GCCATGCGGCGCAGACGTAGCTCTGACCCTCTAGGTGACA
CTGCTTCTAACTTGGGCAGCGCTGTAGACGAGCTTATGCG
GCACCAGCCCACACTTAAAACGGATGCAACAACAGCCATT
ATCAAGTTGCTAGAGGAGATCTGCAACTTGGGCAGATCAC
CGGAGTACATCTGCCAGAAACCCTCCATACAAAAAGCAGA
TGGGACCGTTACAGTGCCACCAGCCCGATCAAACCATGCT
GCAGAGGAGGCGTCCAGTGAGGATGAGGAGGAAGAGGAGG
CTCTGCATACCTTTAGCCAACAGCAGGGGGAGCCAGAGAG
CAACAGGCAAGTGGTGGGAACAGAGGAACGAATCCCCATT
CCTCTTATGGACTACATTCTGAATGTGATGAAATTTGTGG
AGTCCATTCTTAGTAACAACACAACAGATGACCACTGTCA
GGAATTTGTCAACCAGAAAGGACTCCTACCACTGGTGTCC
ATCCTTGGGCTGCCAAACCTGCCTATTGACTTCCCCACCT
CTGCTGCCTGCCAAGCTGTGGCAGGAGTCTGCAAATCTAT
ACTAACTTTATCTCATGAGCCAAAAGTCCTCCAGGAGGGT
CTGTGTCAGTTGGACAGCATACTCTCTGCTCTGGAGCCAC
TTCACCGGCCCATTGAGGTTCCTGGAGGCTCTGTTCTGCT
CAGAGAGCTGGCTAACGCAGGCCATGTCACAGACGCCACA
CTGTCTGCACGCGCCACCCCACTGCTGCATGCCCTCACAG
CGGCACATGCGTACATCCTCATGTTCGTTCATACCTGCAG
AGTCGGACAGAGCGAGATTCGTGCTATCTCTGTGAATCAA
TGGGGATCTCAACTGGGTCTTAGTGTTTTGAACAAACTGA
GTCAGCTGTATTGCTCTCTGGTGTGGGAGAGCACTGTGCT
ACTGTCCCTCTGTACACCAAACAGTTTGCCTCCTGGCTGT
GAGTTTGGTCAGGCTGACATGCAGAAACTTGTGCCTAAAG
AGGATAAACCTTCTAGTAGCACTGCAGCTACAGGACGGAG
AACTGCTGAGACCGAGTCCTTGTCTGCGGGGGTGGATCCC
TCTGCTCAGGGTTTGCTGGAAGGAATGGGACTGGATGGAG
ACTCTCTGGCTTCAATGGAGACGGACGAGCCCACAGCCAC
TGACCCCAAGACCAAGTCCAAACTGACCCCTGCCATGGCA
ACACGCATCAAACAGATAAAGCCTCTGCTCTCAGCCTCGT
CTCGATTGGGGAGGGCTCTGGCTGAGCTGTTTGGACTGCT
GGTGAAGCTTTGTGTGGGCTCACCTGTTCGTCAACGGCGC
TCTCACCATACCACCAGCACAGGAACTGCCCCGACACCGG
CAGCACGTGCCACCGCTTCTTCTCTTACTAAACTCCTTAC
CAAGGGTTTGAGCTGGCAGCCTCCTCCCTACACACCAACA
CCACGCTTCAGGCTGACTTTCTTTATCTGCTCTGTGGGTT
TCACTTCACCCATGCTGTTTGATGAGAGGAAGTACCCATA
CCATCTGATGCTGCAGAAGTTCTTCTGTTCTGGTGGACAT
GATGCGTTGTTTGAGACATTTAACTGGGCCTTGTCCATGG
GAGGTAAAGTGCCCGTGTCTGAAGGCTTGGAACACTCAGA
GCTGCCTGATGGAACTGGAGAGTTCCTAGACGCCTGGTTG
ATGCTAGTAGAGAAAATGGTGAACCCCAGCACTGTTCTGG
ACTCTCCACATTCCCTACCTGCTAAAGTGCCTGGAGCAAC
ATTCACTGCCCCGCAGTTCAGCGCCTTGCGCTTTCTTATT
GTCACTCAGAAGGCCGCATTCAGCTGTATCCGTAACCTGT
GGAACCGAAAACCCCTGAAAGTCTATGGTGGACGCATGGC
TGAGTCCATGCTGGCCATTCTGTGCCACATCCTCCGAGGA
GAACCGATCATCCAGGAGCGACTCTCCAAAGAGAGGGAGG
GCACTGCTCGGCCTGAAGAGGAAAGCAGCTCCGCAAGCAC
TGCGCCAGCCAGCGGCCCTTCAGGAACAGCCGGAGTAGTT
GGAGAAGCACTAATGGACATGGGCTTCTCCAGAGAGCACG
CAATGGAGGCTTTGCTGAACACCAGCACTATGGAACAGGC
CACTGAGTACCTGCTCACACACCCTCCACCACTGCTCAGC
GCGGCTGTCAGAGAGTTCACCATGTCTGAAGAAGACCAGA
TGATGCGGGCCATTGCCATGTCTCTAGGTCAAGAAGTTAG
CATGGAGCAGCGCTCAGACTCACCTGAGGAAGCAGCTCGC
AGGCGTGAGGAGGAGGAGAGGAGAGCGAGGGAGCGGGTAG
AGGAGGAAGAAGCTCGTTGTCTGGAGCGCTTTCTGGAAGC
AGAGCCTCTTGACACCACTGAGCTTCATGCCTTCACAGAC
TCCATGCTGCCTGGCTGCTTCCACCTGCTCGATGAGCTGC
CGGACACAGTCTACCGCCTCTGTGATCTGCTCATGACTGC
TATTAAAAGAAACGGCCCTGAATACAGAGACCTCATCCTT
AGACAAGTGGTCAATCAGGTGTGGGAGGCTGCTGACGTGT
TGATAAAGGCTGCAGTGCCGCTAACCACCAGCGACACCAA
GACAGTCTCTGAGTGGACCAGACAGATGGCGACCCTCCCT
CAGGCCTCCAACCTGGCCACCCGCATCCTGCTGCTCACGC
TGCTCTTTGAGGAGCTGAAACTCTCCTGCGCTCGGGTGGT
GGAGAGCAGTGGTGTCTTGACTGTGCTGATTAAGCTGTTG
GAGGTGGTGCAGCCCTGTCTGCAAGCTGCCAAAGAGCAGA
AGGACATCCAAACGCCCAAATGGATCACCCCTGTGCTCCT
ACTTATTGACTTTTATGAGAAAATGGCTGTTTCATCCAAA
CGAAGAGCTCAGATGAACAAGTACCTCCAGCCCAATGGGA
ATAACTGGCGCTGGTTTGATGACCGTTCAGGCCGCTGGTG
CAGCTACAGTGCAAGTAACAACAGCACTATTGACTCTGCA
TGGAGGGCAGGAGAGACCAGTGTCCGATTTACAGCTGGCC
GCAGAAGATACACAGTTCAGTTCAACACCATGGTGCAGGT
AAATGAGGAGACTGGCAACAGACGACCAGTTATGTTGACG
GTACAGCGGGTGCCACGCATTCCCAAGGCAACAAAATCCG
GAAGTGTTACTGACACGGAGAGAGAGGAGAGTGAACAGAG
AGCAAAGACTGAGGAAACACAGACTGACACAGATTCCAGC
TCTGTGGCTGTAGAGATGGCGCCCCCTAAAGAAGAATCTG
AGCTGAAGGATTCAACCCCAGCAGCTCCGTCAGTTCTCCA
GGACCCCTCTGGTTCTAGTGGTATCGTTGTGCAGGGGCTG
ACAGAAGACATGATCACCATTTTAATCCGTGCCTGTGTCA
GCATGATCAGTGTTCCTGTGGACCCAGACACTTTGCACGC
CACCTTGCGGCTCTGTCTGCGCCTCACACGCACACACCAT
TACGCCATGATGTTTGCAGAGCTCAAGAGCACCCGCATGA
TTCTGAATCTCACCCAGAGCTCAGGCTTTAATGGCTTCAC
CCCATTGGTCACCCTGCTCTTCCGCCACATCATAGAGGAC
CCGGCCACACTGCGGCACACTATGGAGAAGGTGGTACGTT
CTGCAGTCACCAGTGGTGCAGGAAGCACTACTTCAGGTGT
GGTGTCAGGTAGTCTGGGCTCCAGGGAAATTAACTACATC
CTGCGAGTCCTTGGCCCAGCGGCCTGTCGCAATCCAGAGT
GCTTTACGGAAACTGCCAAGAGTTGCATCCGAATTGCTCT
CCCGGCTCCAAGAGGTGCTGGCACTGCCTCAGATGACGAG
TTTGAGAACTTCAGAATTAAAGGTCCAAATGCTGTGCAAC
TCGTGAAGACCACCCCCCTAAAGCTCTCCCCGTTGCCCTC
CATACCAGAGACTATAAAAGAGGTCATCTATGACATGCTG
AATGCCCTGGCAGCATATCACGCACCAGAAGAGGCAGAGA
GAGGAGAGGAGCGGGCAAACGCTGTACCAGGGAATCAAGA
CCTGTGTCAGATCCTGCAGGATGTCGGTGATGATGTCTAC
CAGCAGTACAGACTCACCAGACAAGGCAGTGATTTTGACT
CGCAATCTGCCTTCCCCATCAATACTCAGGTGTTTGCTGC
AGATGGTGCTGTAGCTGAATCTTCTCAGTCTGGAACTCCA
CAGGGAGAAGCCTCTACACCCGAGGAAATGCGTGAAGAGA
AAAAGGAGCAGGAAGGAGACAAGGGAGCTTCTTCGGAGGA
GAGCCGAGCTGCTAAGGCTAAAGCTAGCAAACCTCTGATG
CCCACCTCTACCATCTTGAGGCTGTTGGCCGAGCTGGTTC
GCTCTTATGTTGGCATTGCCACTCTTATCACCTCTTACAA
CTACACAGCTGGCCAGTCGGAGCTCATTAAGGAAGATTGC
AGTGTGTTGGCATTTGTTTTGGACCACTTGCTCCCACACA
CCCAGAACTCTGAAGATAAGGACACCCCTGCCCTTGCACG
CCTTTTCTTGGCCAGCCTTGCTGCAGCTGGCACGGGCACC
GATGCCCAGGCTGCACTGGTCAACGAGGTCAAAGCTGCTT
TGAGTCGAGCATTGGGCATGGCAGAGGGCACAGAGAAACA
CGCCCGTTTGCAAGCAGTGATGTGCATCATCAGCACCATT
ATGGAGTCGTGTCCTTCCACCTCCAGCTTCTACAGCACAG
CCACAGCTAAGACCCAGCACAACGGCATGAACAATATCAT
CCGGCTCTTCTTGAAGAAAGGCCTTGTCAATGACCTGGCC
CGTGTGCCTCACAGCCTTGATCTATCCAGTCCCAATATGG
CAAACACAGTAAATGCTGCTTTGAAGCCTCTGGAAACATT
GTCGCGAATTGTGAACCAGCCCAGCAGCCTGTTTGGTGGT
AAAGGGGGATCCAGCAAGAACAAGACTGAACATGACACTG
TTGGCACAGTCAGAGACAGTAACAGCAACACTCAGGATCA
AGGAGAAGTGGGTGAGGCAGAGCCGGTTGAGAATCGTGAC
CGAGGTCAAGCCACAGACTCTGACCTGATGGATGGAGAAG
CCGAGGGAGACACTGTGGTCATTGCTGGACAGCCTGAGGT
GCTGAGCACTCAGGCAATGCAGGTGGAGAACGAGTTGGTG
GATTTGATCGATGAACTTTTAGAGAGAGATGCCCAAACTG
TTAATAGTACCATCATCGTAGGTCGTTCTGGAGAGGATGA
GTCTCAAGAGGATGTGCTGATGGATGAAGCTCCTTCCAAT
ATGAGTCAGGCCTCCACTCTCCAAGCCAACAGAGAAGACT
CCATGAACATCCTCGAGCCAGAAGATGAGGAGCACACGCA
GGAGGAAGACTCCAGTGGTAGCAACGAGGATGAGGACAGT
CAGGATGAAGAGGAAGAGGAGGAGGAAGAAGAGGAGGAAG
ATCAGGATGATGAAGAGGGAGATGAGGATGATGACGATGA
AGGCTCAGAGATGGAACTGGATGAAGATTTTCCAGATATC
AATGCTGCCCCTCATATTCGTTTTGAGCGATTCGACCGAG
ATGATGACCTCATCATTGAGTTTGATAATATGTTCTCCAC
TTCAGCTGACATCCCTCCCTCACCAGGAAATATCCCCAGC
TCCCACCCTCTGATGGTGCGTCACGCTGACCATGGCTCGC
TGACTCTTGGGGGATCGGGCACCAGTAGCAGATTGGCTCA
AGGAATGGGACGTAGTCAACGTTCTCTCCGCCAGCTCACG
GCCAACACAGGCCACACGATCCATGTACATTATCCTGGCA
ACCGTCAGCCTAACCCTCCACTCATTCTGCAGAGATTATT
GGGCCCCAGCGCTGCAGCTGATATCTTGCAGCTGTCCAGC
TCTCTTCCTCTGCAGTCTCGAGGTCGTGCCCGTTTAATGG
TGGGTAATGAAGATGTGCACATTATTGCCCGTTCAGACGA
TGAGCTGCTGGATGACTTCTTCCATGAGCAGAGCAGCACC
GGAGGACAAGCTGTGGTGAAGGTGCCCATACTGCAGCACC
TGGAGAGTTTGCGTGATGAGGAGCTGGAGGAACGCAGGGA
GAAAAGGAGGAGGCAGTTGGCAGAGGAAGAGGAGACTGCA
AAGCAGAATGAGAGTTCTGCAGCAGGGGAGGAGACCAGGG
AACAGAGTCTGCAGGGCTCTGGGATTGGAACAGTCAATGG
AGCTGCAGAGAATGCTGCAGAAGGAGAACAGGCCCAGAGT
GGGGTGTCCTCCTGTCTGGACCCTCCTCGCACCTCTGAGG
GTTTCCTCACAGCGCCCCCATCAGGAGAAGTCACTCCAAC
CACCCCTGCCCCCCATGAACAAGCCCTCGTGTCTCTGGAA
ACAGCCATCAGTCAGCAGGTGCACCAGCCAATCACAGAGC
TGCTGCTGGCCGACTCCAATCCTGACTCTCACGGAGCCTT
GGCAGGGGCAGGGCTTCCCCAGCTCTCAGCACCTGATAGG
CCAAATTGTGAGGCAGAAGCATCTCAGATGGAGATGTCAC
CTGCACCCACTATTGCTTCACTCAGTCCAGATATAGCTGA
AAGTTCAGAGCCTGTGCCAGTGGGTGTGTCTCAACTCGAG
GGTTCGCCCATGGATACGAGCAGTCCCGCTTCAGGAACGC
AGGAAGAGCCGGCTGCCAGCTCAGTTCCATCCAATCACAT
GTCTCAGGAGCTATCAGGAAGTGGTGACAGCGGCCTCACA
GACAGGCAGACAGATGCAGAAACTGGATCAACTTCTGTTT
CATCTCCTGGCGAGACCATGCCTCGGAGTGACAGTGCCGA
TAGCCAGTCGCAGGCCATCCAGGAGGAGCCCCTCCCTTCC
ACCAGCAATGAAGAGGAGGACCCTCTGGCAGGCATCAGTC
TACCTGAAGGCGTGGATCCGTCTTTCTTGGCAGCACTGCC
TGAAGACATTCGTCGGGAGGTGCTGCAGAACCAACTGGGA
ATCAGACCTCCTTCTCGACCTCCTGTCGCCTCCACTCTGA
CAACCACTGCTAGTGCTGTGCTAGGAGGAGGGCCAGGGGT
GACCGAAGTCAGCCCTGAATTCTTAGCGGCTCTCCCACCT
GCAATTCAGGAAGAGGTCCTGGCCCAGCAGCGGGCAGAGC
AGCAGCGTCGGGAGTTATCCCAGCAACCCACACAGGGTGA
TCAACCTCTGGACCCAGTCACATTCATCCAGACCCTGCCC
TCTGAGCTGCGGCGCTCCGTTCTGGAAGACATGGAGGACA
GTGTACTAGCGGTCATGCCTCCAGATATTGCAGCAGAGGC
TGCAGCACTGCGAAGGGAACAAGAGGCCAGACAGAGACAA
CTGATGCACGAGCGCTTGTTCGGTCACAGCTCCTCTTCAG
CTCTGTCTGCCATCTTACGCTCTCCCGCCTTCACCAGCCG
CCTCGGGGGCAACCGTGGGGTACAGTACACCCGGCTGGCT
GTGCAAAGAGGAGGGACGTTTCAAATGGGAGGGAGTGCCA
ATCATAGCAGACCCTCTAGTTCAAACGTTGACTCTCTCCT
GCGCCTGCGGGGGCGTCTCTTGTTGGACCACGAGGCCTTG
TCCTGCCTTCTTGTGCTGCTTTTTGTGGACGAGCCCAAAC
TTAACACCAGCCGCCTCCACCGAGTGCTGCGTAACTTGTG
CTATCACTCTCAGACGCGTGGCTGGGTCATCCGCAGTCTC
CTGTCCATCCTGCAGCGCAGCAGTGAGAGCGAGCTGTGCC
TGGAGACTGCACGCTTGGAGGAGTCCCGTGGCAAACGCTC
ACTAGGCCAGGGCTCATCTAGTGGAGGAAAGGGTTGTTCT
TCATCCTCCCAGTCGGCTATAGCCTCTTCGTCATCGTCCT
CCTCGTCCTCTTCTTCTCTGGAGCTGCTGAACAGGGTGGA
GTCACGGAGTTCCAGTCAGCTCTCCTGGCTGTCTGTATCA
ATGGACGCAGCTCTTGGATGCAGAACCAACATCTTTCAGA
TCCAGCGAGTATCAGGCAGGAAACACGCAGAGAGGCATTC
AGCAGGAGGGAGTGTGAGCGCAGGAGGACTCACAGGTGGA
GTGTCAGGAACAGGAATGACGTGTACAGGGGGAGGTGGGT
CAACTGTTCACATCCATCCACAGGCTGCGCCGGTGGTCTG
TCGACATGTACTGGACACCCTCATCCAATTGGCCAAGGTA
TTTCCAAGTCACTTCACTCAACAACGCTGTAAAGATCCCC
TATCCTCCTCCTCCTCTGAGTTGGACACTCGTCTTTGTGC
CAGCTCAACACCGACTATGAGTGCCAGTTGTCGGTCAGGT
GGCACCAGTCAGAGTAACTCCTCTGCTACCCCAAGTAGTC
TCACTTCTATCCACAATTCCCTGAGCGCCTGCTCTGGTAC
GCCACAGTCCCTAGGCATCTCCACCGACTTTTGGGATCTC
CTGGTCAAGCTGGACAACATGAATGTGAGCCGAAAGGGGA
AGGCCTCCATGAAGACTGTCCCTCTAGGGGGTGTCGGCGA
GACAGAGGGTGCGCTGTTCAGCCTTGAGGCGTCTCCGCTG
GGCCAGCTGATGAATATGCTGTCCCACCCTGTGATCCGCC
GTAGTTCCCTCCTCACGGAGAAACTGCTACGTCTGCTGTC
TCTGATCTCCATCGCTCTGCCTGACAACAAGGCCACGGAG
GTTCCAGCCAGCCATCCAGTGCCTCAGACCCCAACTGCCA
CGCCATCTGCACCTGCTCCTCAAACCACAGCAGGGTCAGG
GACCATCTCAGCAGTGGCAGCTACAGGCACTACGCAGGGT
TCAGTCGGTTCAGTGGGTACAACGCCATCTCAACCAGCCG
CTACAATATCTGTGGTTGCAGGCAGCACCACCGCCTCTAG
CATTATTGCTGGAAAACTGAAGCCAGCAGTAAGCATCACG
GACATTGAATCTAAACTGGCCTCTACTGGACTTACGGAGA
AGCAGCTGCAGCTCTCTGTGGAGGTTCTGACATCTCACTC
GTGTTCAGAGGAAGGTCTGGAGGACGCAGCCAACATCTTG
CTGCAGCTGTCCAGAGGGGACGCACCGACCCGAGACACTG
TGCTTAGACTTCTGCTCAGCGGAGCACGTCACCTTGGATA
CACTCTCTGCAAACAAATCGGCACTTTATTAGCTGAGTTG
AGGGAGTATAATCTAGAGCAGCAGAGAAGAGCACGGGCTG
ATGCTCAGTCTCCTGAAGCTTCTCATGATGACCCATCCAT
CACCACACGCCTCAAGGGCAAGATGACCAGCAGGTTTGAC
GGGTCAGAGAGTGTGGTGATTGTTGCTGCTCAGAAGCGCA
CGTTAGGTGGCCGGGAGCTTCAGTTGCCCTGCATGAGCTC
GCTCACTTCCAAGACCTCAACGCAGAAGTTTTTCTTGCGG
GTACTGCAGGTCATCATCCAGCTTAGAGAAGACACGCGGC
GCGCTAACAAGAAAGCCAAGCAGACAGGAGGAAGACTAAG
TTCAACCAGTCTGGGCTCGGCCAGTAGTATTCAGGCTGCG
GTCCGTCAGCTGGAGGCTGAAGCGGACGCCATCATTCAGA
TGGTGAGAGAGGGACAGAGGGCACGCCGTCTACAGCAGGC
CCCCCCACCCTCTTCATCTGCATCCTCTTCCGCTGCTGCT
GCTGCTGCATCCGCTGCTGTGGCTGTGGCTGGATCGTCTG
CCCCCAGTACCTCTGCAACCAACAACCCCCCCGCTGGCAC
GGCCAGCGCAGCCACGTCGGAGGTTCACACTGTTGCCGAG
CCACCAGCAGCTCAGAGAGATGATTCGCCCATGGATGTGG
ATCAGCCCTCTCCTTTGGAACAGGACCAGCCAACATTAGG
TGAGGAGAGCAGCAGTCAGCAGGAGCAGGAGGAGCGTTTG
CCTGACCTGCCGCTGTTAAGTGAGCAGCTGCTTTTGGATG
AGCTGTGGGACATGCTTGGAGAATGTCTGAAAGAGCTTGA
AGAGTCTCATGACCAACATGCAGTTCTAGTGCTGCAGCCT
GCAGTGGAGGCCTTTTTCTTGGTGCATGCAACAGAGCGGG
AAAGCAAACCACCAGTTCGGGACACTCGGGAGAGCCAGCT
GTCACACATCAAGGATGAGCCTCCACCCCTGTCACCCGCC
CCTCTCACACCCGCTACCCCCTCCTCTCTGGACCCCTTTT
TTTCCAGAGAGCCTTCCTCTATGCACATCTCTTCCAACCT
GCCTCCAGATACACAGAAGTTCCTCCGTTTCGCAGAGACC
CACCGCACAGTGCTGAATCAGATCCTGCGTCAATCCACCA
CTCACCTGGCAGACGGGCCTTTCGCTGTTTTGGTTGACTA
CATTCGCATCTTGGACTTTGACGTCAAGCGCAAGTATTTC
CGTCAGGAGCTGGAGCGTCTGGATGAAGGCTTGAGGAAAG
AGGATATGGCCGTCCATGTGAGGAGAGATCACGTCTTTGA
AGATTCTTACAGAGAGCTGCACCGCAAGAGCCCAGAAGAC
ATGAAGAACAGATTGTATATAGTATTTGAAGGAGAGGAGG
GTCAGGATGCAGGCGGGCTGTTAAGAGAGTGGTACATGAT
CATCTCCAGAGAAATGTTCAACCCCATGTATGCCCTGTTT
CGCACCTCCCCCGGCGATCGGGTCACCTATACCATCAACC
CCTCCTCCCACTGCAACCCCAACCATCTCAGCTACTTCAA
GTTTGTGGGACGTGTGGTGGCCAAAGCAGTCTACGACAAC
AGGCTATTAGAGTGTTACTTTACACGCAGCTTCTACAAGC
ACATCCTGGGCAAGAGCGTTAGGTATACAGACATGGAAAG
CGAAGACTATCCCTTTTTCCAAGGTCTGGTTTATTTGTTG
GAGAACGATGTGTCGACTCTGGGCTACGAGCTGACATTCA
GCACAGAGGTCCAAGAGTTTGGCGTGTGTGAAGTGAGAGA
TCTGAAGGCCAACGGTGCCAACATTCTTGTCACAGAAGAG
AATAAGAAGGAATATGTGCATCTGGTCTGCCAGATGAAGA
TGACAGGTGCAATCCGTAAACAGCTGGCTGCCTTCCTGGA
GGGCTTTTATGAGATCATCCCCAAGAGACTGATCTCCATC
TTCACTGAGCAAGAGCTGGAGCTGCTCATCTCCGGCCTGC
CCACCATTGACATCGACGACCTCAAGGCCAATACTGAATA
CCATAAATATCAGTCCAGTTCTATTCAGATCCAGTGGTTC
TGGCGTGCTTTACGATCCTTCGACCAGGCTGACAGGGCCA
AATTTCTGCAGTTTGTTACGGGCACTTCCAAGGTGCCACT
GCAGGGCTTTGCTGCACTGGAGGGAATGAACGGCATTCAG
AAGTTCCAGATCCACCGAGATGACCGCTCCACTGACCGCC
TGCCCTCTGCGCACACTTCTTTAACCAGTTGGACCTCCCA
GCGTACGAGAGCTACGAGAAGTTAAGACACATGCTGCTGC
TGGCCATTCAGGAATGTTCTGAAGGCTTCGGACTGGCCTA
AAGACTCTCCTAACCCCACACACAGATGTAGACTTACACG
TCGTTAACTTATGACACACATGCATATTCACACTATCATA
CATACGGCCAAGACCTACGTCTAATCCACATAAAACAAAG
AAACGGACGGAGTGACAAGAGATGCGTTGACATTGCCTAC
TACACACAGAGCCTCTCATTGACACACCGAACTGTATTTG
GTATATGTGTGTGTCTCACTTCCCTATTAAAATTACAGAG
CTCGAGAGAGGAAACACAGAGGATATCTGCGGACTAATAT
AAAAGACATTTTCTCCATTTAGTTTGGTTTCTCTGTACAA
AAGGTTTGGGAGTTTATTATGTTTAATCTTTTTTGTTCTT
CTCTGGCTGTTTAAAAACAAACAAACGAAAAAAAAAGAAG
CAGAGGGCAATTTTGTGTGTGTAAAGAAGAGGGGGAAAAG
TTGATTGTCCTCTGTTGCTAATGTGTGACCTCACTAGCTT
TGCAAATGGAAACTTTAATTTAGGGGAGGGGGAGAACATG
AAATACGGATTTAGTGAAATCGCAGACGTGCAGGGATTTT
CAGAACGGGGACATTTTTAGGCAACTTTTGTGGTATTTTT
GGAGAGGAACACACGGATTTGCGAAGTGAAGGACTGAGAC
GTTGAACCGCGGGTGTTCAGACACGTGCGGTTATTACCCA
ACTGCTGATGCAGCCTCTCAGCAGCTAATCAGAACGTAAA
TTGCTACATAAATAAATGCATAAAATGAGCCCACTGTGTC
CTCTAGAGTTGTTTCAATGTATGCCTTACACATTTGCACT
AACAGGAGCAAATATCATTTATATGTTAAGAAAAAAATAT
ACTGATGGAGGTCCATGGAAACTAACTTGACACATGCTGT
GGGGTCCAAGTATTAAAAGCTCTATTCTTCATCCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
huwe1-202 Contained in:
OTHER huwe1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038190 (1)
  • Ensembl_Trans:ENSDART00000146990 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EV758859 (1) 1029bp
    GenBank:EV759595 (1) 918bp
    GenBank:EH554312 (1) 893bp
    GenBank:DN857572 (1) 729bp
    GenBank:DT080713 (1) 726bp
    GenBank:EB929887 (1) 604bp
    GenBank:AL909144 (1) 539bp
    GenBank:AL923841 (1) 537bp
    GenBank:AL925452 (1) 520bp
    GenBank:AW305857 (1) 403bp
    GenBank:CT636464 (1) 244bp
    CITATIONS (2)