header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1858
Transcript Name: cnot9-201
Previous Name: rqcd1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010915 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010915|OTTDARG00000009517|ZDB-GENE-030131-1558 rqcd1|OTTDARP00000009398 rqcd1-001 LG_ BX548072.14 Danio rerio protein_coding KNOWN, 1420 bp
GGAGCGTAGAAGAAGAGGCAGCTGCGGAAGGCGGTTGTTT
TTTTCCCCTTACCTCATTTGCTAATGTAAACCTGGTTTAT
TTCTCGTTGTTTTGAAAACCACTGTTCACTTTTATTCTGG
AGAGCACAGTAAAGCGGTCGCGAGGATGTTGGCGACAGGA
GCGACTGTAAGCACAGCGGGTCTGGCGCAGGTGGACCGGG
AGAAGATCTACCAGTGGATCAATGAGTTGTCCAGTCCAGA
AACACGAGAGAACGCCCTGCTGGAGCTCAGCAAGAAGAGA
GAGTCTGTGACTGACCTGGCCCCAATGCTCTGGCACTCCT
GCGGGACCATAGCAGCTCTACTGCAGGAAATTGTTAACAT
CTACCCATCCATAAACCCCCCGACACTGACGGCACATCAG
TCTAATCGAGTGTGTAATGCCTTAGCACTGCTGCAGTGTG
TGGCGTCACATGTAGAGACACGTTCTGCTTTTCTGGCAGC
TCACATCCCTTTATTTCTCTACCCGTTCCTGCACACGGTC
AGTAAAACCAGGCCCTTCGAGTACCTTCGGCTCACCAGTC
TGGGCGTCATCGGCGCACTGGTGAAAACAGACGAGCAGGA
AGTCATCAACTTTCTGTTAACCACAGAAATAATTCCTCTC
TGTCTGCGCATAATGGAGTCCGGCAGCGAGCTCTCCAAAA
CGGTGGCCACGTTTATCCTGCAGAAGATCCTCTTGGATGA
TACGGGGCTTGCCTACATCTGCCAGACCTACGAACGCTTT
TCACATGTAGCCATGATACTGGGGAAGATGGTTCTTCAGT
TGTCTAAGGAACCCTCGGCTCGTCTGCTTAAACATGTTGT
GCGCTGTTATTTACGACTTTCTGACAACTCCAGGGCGAGA
GAAGCTCTGCGTCAGTGTCTGCCCGATCAGCTGAAAGACA
CCACATTTGCTCAAGTTCTGAAGGACGACTCCACCACCAA
ACGCTGGCTCGCTCAGCTGGTCAAGAACCTGCAGGAGGGA
CAGGTGACGGACCCACGCGGCATCCCTTTACCTACTCAGT
AACACACAAACACTGATAAACACACACACTCAGGACGCCA
GCACAGCAGCATCTCGCACACATCTGACACATTTTTACAC
ACAAGGGCACTTAATATTTTTTGGCCAAGAAGTTCAGAAA
CGGTGCTCAGATTTCACGGTTTGATTTTATTTCTTTTTTC
GAGATGTTTAAATTGACTTTGGACTCTGCTGGACTGAGGA
AGAGTCAGTCTCATCCATCATTAGGGATTTGCTTTTTTTC
TACATCTTCTTGATGGAATCCTAAAGAAGATGATGAAAGA
CTGTTTTGTCTGTATTTTCATCCTAAACTAAAGGAAATGT
GTATTTTGAATGCTGTTGAATAAACAGTGCCATGCCATGG
GAAATGTCATGCGAAACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cnot9-201 Contained in:
[BAC] DKEYP-84A8 (1)

OTHER cnot9-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000010915 (1)
  • Ensembl_Trans:ENSDART00000143574 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK027127 (1) 802bp
    GenBank:CF348455 (1) 768bp
    GenBank:CD284046 (1) 667bp
    GenBank:BM571170 (1) 631bp
    GenBank:AI545381 (1) 607bp
    GenBank:AI496718 (1) 604bp
    GenBank:AI477335 (1) 581bp
    GenBank:BM141305 (1) 576bp
    GenBank:BM532851 (1) 570bp
    GenBank:BQ258941 (1) 553bp
    GenBank:AI497537 (1) 542bp
    GenBank:BM530273 (1) 496bp
    GenBank:BQ074265 (1) 375bp
    GenBank:CB364012 (1) 292bp
    GenBank:CB355610 (1) 125bp
    CITATIONS (2)