header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1838
Transcript Name: sass6-201
Previous Name: sass6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010832 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010832|OTTDARG00000009448|ZDB-GENE-040426-2784 sass6|OTTDARP00000009325 sass6-001 LG_ BX908398.10 Danio rerio protein_coding KNOWN, 3346 bp
CAAATGTTTTCAATTTTATCAGCTTTATTCACGCACAACT
ACACAGTATATACAGCTTTAAATGTTTATATCTATATTAT
ACGATTTATAAAAACAAAAACATGTTGAAATACGATGATA
CGCGTGATTAGGTTGAAGTGTTTCTCACTTCCGGTTGGAA
ACGGACAAACGCGGGAGTGAAGCGCGAAAAACAAATGAGT
CTTTCAACAACCTAAATAACATCTTTAAAACAGGATTACA
CGATTTTTAATTATTATCGTTGCTTTGTGAATGAATTAGG
AATGACGGAATTACTTTTTAACAAGCGGTTGCAGGTGCTG
GTGAAGAGTAAAGATACCGATGAGAGGCGTTCGGTTATTC
GCGTTAGCATTGAACTGCAGTTACCATCCAGCCCTGTTCA
CAGAAAGGATTTAGTTGTACGGCTGACTGATGATACTGAT
CTTTACTTTTTATACAACCTTATCATATCAGAGGAGGATT
TTCAAAGCTTAAAAGTACAACAAGGGCTTTTAATAGACTT
CACATCATTCCCACAAAAATTTATAGACTTACTTGAACAG
TGCATTTGCGAACAGGACAAAGAAAACCCACGGTTTCTTT
TACAGCTCTCGTCATCTTCATCAGCGTTCGATCACAGTCC
TTCAAACCTCAATATTGTGGAGACAAACGCATTTAAACAC
CTCACACATCTCTCTCTGAAGCTGCTGCCAGGATCTGACA
CTGATATTAAGAAGTATCTGGCCAGCTGTTTGTCTTCTGT
TAAGGAGGAAAAGCAGCAGTTGCAGCAGAAGTTGAGAAAG
ACTGAGGAGGATCTGACAAGACAGCTAAATTATGCACAGC
AAACTCTGTCTGAGAAAAGTCGAGAACTGGACAAACTTCG
GTCTGAATGGACGTCTCAAACAACCTCTCTGTCCAGCAGA
CACATGCAGGACCTCACCGCTGAGCGGGAAAAAGCTCTGG
AGACTCAAAGTCGTCTGCAGCAGCAGAATGAACAGCTGCG
TCAGGAACTGGAGTCATCTCATCACAGAAGCACCCAACAG
CTCCAGACCAAAGTCTCTGAGCTGGAGACGGCGAACCGAG
AGCTCATCGACAAGAAATACAAGAGCGACTCCACCATCCG
AGACCTCAAAGCCAAACTGACCAGTCTGGAGGAGGAGTGT
CAGCGGTCCAAGCAGCAGGTGTTGTCGTTGAGGAGGGAGA
ACAGCGCTCTGGACAGCGAGTGTCATGAGAAGGAGCGTCT
GCTGAATCAGCTGCAGACACGAGTGGCCGTTCTGGAGCAG
GAGATCAAAGATAAAGACCAGCTTGTGCTGAGGACCAAAG
AAGTGCTGGAGGCCACGCAGCAGCAGAAGAACTCTGTGGA
AGGAAACGCTGAGAGCAAGCAGCTTCAGATCAGCAAGCTG
GAGTCCACAGTGAAGTCTCTGTCAGAGGAGCTCATCAAGG
CAAACGGCATCATCAAGAAGTTGCAGGCAGATCTGAAGGC
TCTGCTGGGGAAGATCAAGGTGAAGAACAGCGTCACCGTT
TCTCAAGAGAAGATCCTGCAGGAGACCAGTGACAAACTGC
AGAGACAGCAGAGAGAGCTGCAGGACACACAGCAGAGACT
CTCACTGAAGGAGGAGGAGGCAGCAAAATTAAAGGAGCAG
TTGGAAGCTACTGTTCAGAAGCTGGACGAGAGCAGGGAAG
TGTTAAAAACTAATGAGAATGTAATAACGTGGCTGAACAA
GCAGCTGAATGAGAATCAGCTCTCCAGAAAGCAGGAAACT
GTAGCCATGTTTGAGACGCCTGCAGCGGCACTGAGATCAG
CCGCTGTCCCGCACAATATGGCTTTCCCCATCACCTCTAC
CATAAACTCCAAATATCCTCTTGCCCTGTCATGTGTGAGC
TCAGGATCTCGATCTGTCCTGACCAGCAGCAATGGACCCA
AGGTCCAGTTTAACCCGATGAGTGTCAAACCTTCAGCAGC
AGAGGTGAGTCCAGCTGCTTTTTCCCAGCCGGCCAATAAA
GAGAACAGTGAACCTGTAGGATTGGACTCAAAGTACTTTG
AGAGACGAGATGACAGCATTCCTCTTCGTGGCCTTCTACC
CAGCATGCATCTAAATAGAGAAGTTCCAAAGCCACTGAAC
ACAGCTGCAGCGAAAGCAACACCATCAGCGTTTTTTCCAG
GATGACGAGCAGCAGGTTAATCCAGATTCATCACTGGGTT
TTCTGTGTGAACGCTACTGTTAAATGGAAGAGTCTGCATT
GAAAAGTCTCAGTGCAGATTATATTTTTAATAGTTTGTTT
TCAGTTATTTATTAAAATATATATATATTTAAAACGATTT
TGCAGTCTGTTTGGAAAGAGGATCAGTCAGACTTTGAGAT
TATTTTGTCATTTACTCACCTTGGTGTCGTGAGGGAGCTT
TTTTTTTATCCGTTCCTCTTTTTAAATGTCCATGTAACAG
CAGTAGTCAAGCTTAATAAAGGTGCCGCAGAGTCACAAAA
CTGCGTCCAGAAAGAGGTATATTACTTGTAAGTTATAGTT
ATGTGGGGGGAAATGAAACAAAACTGTATTAATTATTTAA
CGGAATAATAATTTTGACCGCTGGTCTCTTTAAATGAGGC
GCGAGCATTAGACAACAACTCGTCCCAAGTGCCCCGGCAA
AAGAAATCGAGATTATTATTATTATTAGCGCTCCTCAAAT
ACTGTTAAAGTACTTTATTTTTTGTTTTGAGGTAAATATA
ATTGTTGTACGTCGCAAACCGTTCACGTGTCATCTTACGA
GATATTGAAATCTGTTAAGAAACCGCTAGATTCAAGGTTA
CACTTTTCATCGCGTTTGTAGTCATGATTTTTAAAGTTAA
TAACATTTAGGTTAAAAAAAATGGACGCGTGTATGCAAAA
CGGAGGATTATTTTTCGTTGGAATAAACCGCCTTTTTTTT
TTTTTTTTTTTGCCCCCTCAAAGCATCACGTCCCTCAGTA
CTTTTGAAAGAAGACTTTATTTTTATAAAGCGCTGATCAT
AAGCACATGGTGTGATGAGGATAAATAGGCATGCATACAG
CATTTGGACATCACCAGGGTGAGTAAATGATTTTAGTTTC
ATCTTTTTGTGAAGTCTACATTCAAGTTCTTATTTCAGTG
CCAAATATAAAAAGTCTCTCAATGATTTACACTCAGAGAG
CTGCCATTTTGCATTGATCATTCAGTTGGCAAATGTAAGT
GCCTGACATGATATCTGTACAGCTGTATAGAATTCATTGT
GTACATTCATATTTTTGTATTTATGGTTTGACAGTGTTCT
CCATCATGGGTTAGTTGTTCATCAGTAGCGGTATTTTAGG
ATTAAGTTAATAAAATATTAAACACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sass6-201 Contained in:

OTHER sass6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000010832 (1)
  • Ensembl_Trans:ENSDART00000081191 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045420 (1) 3169bp
    GenBank:CN013939 (1) 863bp
    GenBank:CD597652 (1) 650bp
    GenBank:BQ450158 (1) 628bp
    GenBank:BQ449942 (1) 617bp
    GenBank:BI984443 (1) 594bp
    GenBank:BG304241 (1) 592bp
    GenBank:BQ074862 (1) 569bp
    GenBank:AI588697 (1) 547bp
    GenBank:BI984167 (1) 527bp
    GenBank:BQ074647 (1) 524bp
    GenBank:BG737802 (1) 504bp
    GenBank:AI588253 (1) 454bp
    GenBank:AI558329 (1) 428bp
    GenBank:CD593113 (1) 367bp
    CITATIONS (2)