header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18374
Transcript Name: or111-1-201
Previous Name: or111-1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037977 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037977|OTTDARG00000028027|ZDB-GENE-000329-16 or111-1|OTTDARP00000030435 or111-1-001 LG_ AL845428.5 Danio rerio protein_coding KNOWN, 1145 bp
ATCTCGGTGGCATGCTTGAATAAGGACAAACGTTTATGCG
GTATTGGTTCCGTCGAGTTTACAAGACAGTCACTGTCATT
GCTGGCTCTAAAACTTTGGAGTTATTCAAATATTATGCAA
AGTTATTTTAAAAGATTTTTCAAAACACAAGACGCAAAGC
TGCCATGAGTTCTGTAAATGCAAGTTTTTCCAAGAATATC
TCCATCGTTCATCCTGAATACTTTTTCGTCATTGGGCTCA
CAGGTATAGGGTACAGCAGTTATTACTATATATTCTTATT
CATCACGTATTTCATAACTGTAGTTGGGAATACTGCAGTC
ATTCTCATTATAGTTCTTGACCGGAGGCTGCACAGTGCAA
AGTACATTGGTATGTTTAACTTGGCCTTGGCTGACTTTGG
GGAAGCTAACGCACTGATTCCTAACATGATGAAGACTTTT
CTGTTTGACTCTCAGTACATCTACTACAATGCTTGTATGG
CAAATATGTTTTTTGTGTTCCTCTTTAGTACTATGCAAAG
TTTCACTCTTGTTGTTATGGCGTATGATCGTTTAATTGCA
ATTTGTTTGCCATTGAGATATCATAGCATTGTCAATAATT
CCAATATGATTTTAATTTTCTCAGCAATATGGGCTTTTAA
TTCTTCTGTGGTGGCCTTGATGGTGTCTTTGATTGACCGA
CTTTCATTCTGTGAATCTAATATGATACAGAGTTATTTTT
GTGATCATGGACCAGTGTATAGGTTGGCATGCAGTGACAT
TAGCAAAAATAAGATTATGGCGTATGTCATTTCAGCTATG
TACATTATAGCACCAATGGTCGTTATTGTCTTTTCATATC
TGGGCATTTTTCTTGCTTTAATCAAAATCACAACTTGGGA
AGGACGATTAAAAGCACTGAAGACCTGTGTGTCTCACCTG
TTGTTAGTAGGAATTTTTTTCCTCCCCTTATTCTGCACAT
ACCTTGCCCAGCTCTTGCTTTCACTGAATCCTAATGCCAG
AGTCATCAGCACATCTCTGTCATATGCAATTCCACCAATG
CTAAATCCTATTATTTATGTTTTAAACACAGGTGAAATTA
AGGACCTAATTCGAAAAATGCTTAAAAGCAGATCTGCACC
GATCAGAGAGAACATTTCCAAATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
or111-1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037977 (1),  Ensembl_Trans:ENSDART00000060124 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CO804187 (1) 851 bp
CITATIONS (2)