header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18030
Transcript Name: zgc:158689-203
Previous Name: zgc:158689-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037627 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037627|OTTDARG00000027813|ZDB-GENE-070112-1902 zgc:158689|OTTDARP00000030157 RP71-15H11.1-003 LG_ CU302315.7 Danio rerio protein_coding KNOWN, 624 bp
AGACATTGTCCAGAAGAGACAGACAGCGAGCCGCTCGAGC
TCCACAGACCCGCAGCAAATGGACATTCCGCGGCCGGAGA
GGATGAGAGTTTGACGCGGTCATGGAGGAGCGTGAATGAA
GAACAATGAGCAGCGAGTGCTGACCTGGAAACAAAAGTCG
GAGAAAGAAAAGTGAAAAACACAGCAGACAAAGCGCCGAG
GACACGATGAACATTGACAAGTTGCGTCTGCTGTGATTCC
TGAAGTCTGAAAGCAAGGTGAAGCTGGAGAGAAATCACAA
TGTCACGCTCAGATGAGGTCAACAAGATGACAGAAAATGT
CTACAAGGGCATTCTGGACCAGTTCAACCCCAGTCTGAAG
AATTTCGTCACTATGGGGAAACACTATGAAAAGGCTCTGA
CTGGCGTCACAGTGGCAGCTAAAGGATATTTTGATGCGCT
GGTTAAACTTGGAGAGCTGGCCAGCGATAGTCAGGGCTCA
AAAGAACTGGGCGACACGTTGTTCCAGATGGCGGAGGTTC
ATCGGCAGATCCAGGTCCAGCTCGAGGACGTGCTGAAGCT
GTTTCATTCAGAGCTGCTGTCTCAGCTGGAGCAGAAACTG
GAGTTAGACATCAAGTATCTCACT

zgc:158689 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:158689-202 (1)    Ensembl 1217
zgc:158689-203 624
zgc:158689-204 (1)    Ensembl 268
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:158689-203 Contained in:
[BAC] RP71-15H11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037627 (1),  Ensembl_Trans:ENSDART00000134198 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB955335 (1) 604 bp
GenBank:EB773535 (1) 509 bp
CITATIONS (2)