ZFIN ID: ZDB-TSCRIPT-090929-17961
Transcript Name: otud7b-201
Previous Name: otud7b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037552 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037552|OTTDARG00000027780|ZDB-GENE-060616-1 otud7b|OTTDARP00000030098 otud7b-001 LG_ CR933818.11 Danio rerio protein_coding KNOWN, 3648 bp
GATATTTACATAACACAACAATAGCACACAACCCAAGAGG
AAGTATTTTCTGCGAGCGAACAGCCAAGAGTGGGAGGAAA
TGAGAGAGAAATTCCGCGAGGCCGCTCGAGGTGTGGCCCA
AACTGTGCTGTTGCTGTGAGGGAGAATTGCTCTCCTGTTT
TTTCTCTCTCCTGATGCCCCCTTCTGCACTGTAAATTCAT
GATCACATGACTTTGGATATGGACGCAGTCCTGTCCGACT
TTGTCCGTTCTACTGGAGCTGAACCCGGACTGGCCAGAGA
CCTGCTGGAGGGAAAGAATTGGGACCTCTCAGCTGCACTG
AGTGACTTTGAGCAGCTGAGACAAGTGCATGCTGGGAGCC
TCTCATGCAGCTTTGTTGAGGAGAGTGAGTACCCCTCCAT
TGAGAAGGAGATGGCACGGACAGGACGGCCCCTCTTACAT
CGACAAGATGAGGCTGTTCAAGCCACAGAGAAGAGACTGT
CGAGAGGAATCTCTCACGCCAGCTCCACCATCGTCTCCTT
GGCCCGCTCGCACGTGTCCAGTACAGGAGGAACCAACGAG
CAGCTTCTGGATACCCCGCTCTGCACATTCCAGTTGCCGG
ACCTCACCGTTTACAGAGACGACTTCCGCGGCTTCATCGA
GAGAGATCTCATTGAGCAGTCTATGATGGTGGCTCTGGAG
CAAGCTGGTCGGTTGAACTGGTGGACTCGTTTGGGGACAG
GCTGTCAAAGTTTATTACCTCTAGCCACAAGTGGTGATGG
GAATTGCCTGTTACACGCAGCCTCTCTGGGAATGTGGGGC
TTCCATGATCGAGACCTGATGCTGCGGAAGTCTCTCTATG
CACTGATGGATCATGGGCAGGAAAGGGAGGCTTTAAAGCG
AAGGTGGAGATGGCAGCAAACCATGCAGAACAAAGAGTCG
GGACTGGTTTACACAGAGGAAGAGTGGCAGAAAGAGTGGA
ACGAGTTGTTAAAACTGGCATCTAGCGAACCAAGGATACA
CTACAGCACCAATGGCAGCAGCGGTGCCGAATCGCAGGAG
GAGCCAGTGTATGAGAGCCTGGAGGAGTTTCATGTGTTCG
TTCTTGCTCACGTGCTCCGCAGGCCCATAGTCGTGGTTGC
TGACACCATGCTACGGGACTCTGGAGGAGAAGCTTTTGCA
CCAATTCCTTTCGGAGGGATTTATCTGCCTTTGGAAGTAC
CAGCCAACAAGTGTCACCGCTCCCCTTTGGTTTTGGCATA
TGACCAGGCCCATTTCTCTGCCCTGGTCTCAATGGAGCAG
AAAGACAGTTCCAAAGAACAAGTGGTGATCCCTCTGACAG
ATTCAGATCATAAGATGCTGCCTTTGCACTTTGCTGTGGA
TCCTGGGGCAGACTGGGAATGGGGCAAAGATGACAATGAC
AATGTGATGCTAGCAAGTGTAACCTTATCTCTGGAGGCCA
AGCTCCATCTGCTGCATTGCTACATGACTGTCACCTGGCT
TCCTCTGCCCTGTGAGCAGGCTCCACTGGCACAGCCAGAG
TCACCAACAGCATCTGCAGGAGAGGATGCCCGCACCCCAC
CAGACTCTGGAGAGTCTGATAAGGAGTCCGTTAGTAGCAG
TTCCAATGGCAACGGTGACAGCAGTACTACTGGAACCAGT
GGGACAACAGGCAAAACCAGTGGTGGATCTTCCAGTTCCT
CAAGCTCATCCAGCAACAGTTCAGGAGGAACCACCGGCAC
AATAGGAAAGGAGAAGGGGAAGAAAGATAAAGAAAAGGAT
AAGGACAAAGACAAGAAGCGTGCAGACTCTGTTGCCAACA
AACTGGGAAGCTTTGGCAAGAGTCTGGGCAGTAAGCTGAA
GAAGAATGTGGGAGGCCTAATGCCAGGGAAGAATGCAAGT
GGAACTGGAGGCAAACAAGAGGGTCAGGAGAAGAAGAAAG
GCTCTCTGAGAGGCCGTAAGGGCAGTAAGGACAGCTCTCC
TTCCATTCAAACTGGCTCCGAGGACTCTGGGAAAGGCTCA
CCCTCCTCAACCAGTGAGCGGCAAAATGGAGGCTACTCTT
CGGAAAGTGACCCTTTCAAATACAGCTCGGATGTGAAAGT
TAGTCTTAGCATCCTTCGATCTGCTATGCAAGGTGAAAGG
AAGTATATCTTCTCTGCGCTCCTTACCACCAGCAACCGGC
AGCCGTTCCAAGAAGAAATGATTCAGCGCTACCTGGTCGA
TGCAGAGGAACGCTTTCATGCAGAACAGGAACAGAGAAGG
GAAGCGGAACGGAAAGCAGCAGGAGGTCTTGCCTCGACTA
CTGGACCCCAGATGAAGAAGGACGGACCTGAGCTGAGCTA
CAGAGGTTTTGAAAGCAAAGAGGAAGTTACCGATAGCTCG
CCTCCGAATTTTAATGCGTTGAAATCATCCTCTTTCAGTC
CTGTGATGTACTCTGGTGTGGTCCCAATCCCGAGGCACAC
CTTTATTGACCATTCTCCTTCCCCAATGACACAGCATCTC
CATATGCATCATGGTTATATGGATACACGACGGCAACTGG
CAGGAGGATCACCGTCATCTTACCCAGGCCTGCCATCTTA
TGCTACTCTCCCCAGACATTGCCCTCTAGCACAGGGCCCG
CCTCATGCTCAGTACCACCCGCCCTCCGCCAGCTTGGGAA
GCCCATCCCGTATCATCACCCCCTGCTTGACGTCTTTTCC
TCAAGAGCATGACCCAACTGATTATCCAAGCGAACCCAGC
GGAGCCTACACAAACGGATTGCGGGACTTGCGCTCTACTT
TGGACAGTCGAAACGGGCCGATGCCCGTGAGGCATTACTC
CTTAGGAAGTGCGGGTGGCCTGGCCAACCTGCAGTCCAGC
AAATGCCGAACGCCTACGTGCAATTACTACGGCCACCCGG
AGACAGGCAACTACTGCTCGTACTGCTACAGAGAGGAACT
GAAGAGACGGGAAACAGAGCCAGCCATCCACAGGTTTTGA
ACAGACAACCGTTGGCCTGTTCCTCTCATAATGGACTCAT
TGGAGCCTACAGTGTGAGCCACATCATATCCTATTTGTGT
GGATCTTGCTTTAAAACAATAGATCGGCCTTTCTGAACCA
GGTTATTAGGACTCTGTGTCCACAAATTATGGCCATTGTG
GATATGGGACTGCTGTTGTGTTACATTTGCTGTGGCTCAT
AGGCAGGAGCTTTAAGCTCCTCCCACATTAGCTTGATGTG
GTCATCCTCTTACCTGTCTCTTTGTCTCCTCCTTGTGGTG
AGAATGTAGAGTACAGGCAATAAACATTTGAGTGTAACGT
GCGTCACACAAACACGCCGCATACCCTAAAATACACATTA
AGCACAACCAGAAAACGCGTATTTATATCAGCTGCATTTG
TATACAAAATAAGACATTTCATGTAGGATTTTAGCTGCAA
TCCATGTAAGACTTGCCATATTGCGAGTGTAAGGCAACGA
CACACTGTTAACTTCAAGTGAGTGTTATTCACATTAGCCC
AACGCTACAGTACTTTAACTTGCACCCTTTGGAAAGCCAT
ACCTGGTTGGCTTAAATGAGCTAATATGGTGCTTTTTATT
GCTTGTTCAACTGACGGAGCTAAACCTTGACAGTCAAAGG
TTTCGCTTGAGGTCTTCACATGTCCTTATTAAAAGTCCCA
GTTGTTTA

otud7b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA otud7b-201 3648
otud7b-202 (1) 1920
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
otud7b-201 Contained in:
OTHER otud7b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037552 (1)
  • Ensembl_Trans:ENSDART00000041811 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC125816 (1) 3665bp
    CITATIONS (2)