header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17617
Transcript Name: si:dkeyp-77h1.4-201
Previous Names: ottdart00000037190, zfinnucl0000000760, zfinnucl0000001664, im:6912380-001, si:dkeyp-77h1.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037190 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037190|OTTDARG00000027592|ZDB-GENE-050208-18 si:dkeyp-77h1.4|OTTDARP00000047743 DKEYP-77H1.4-001 LG_none CR848747.9,CU929328.5 Danio rerio protein_coding KNOWN, 3602 bp
ATAAGGGCTTGATTCGCCGGGCTTTACAGACCGCACTCGA
GACGCTGCGAGATACCGGACGGATTCCTAAGGTGCATCTC
CTAGTGCTTAAGTGATTTTCGAGGTGGAAAGGAAGCAGGA
ACGGACGAATAACGGATTTCCCCCTTTATCTCTGTCTTAT
CATTTGATGAGGATACTTGGAGGAGAGGCTTTGCTGTAAG
AGGTGTCATACTGAGACAGAGAGAGAGAGAGAAAGCATAG
CCAGTATGAAGAATCATCATCTGTTCATCTTGAGTTTGCT
GTTCTACTCAGCATTCTCTGCTACGCTGAAAGCCCAAGAA
GCATCGCAGACGTTGTTTTTTGGGGAAGACTTCCACATCC
CCTTGCCGGCAGGAGGAGCTGACGTGTCCTTCAGGCCTTC
ATTTGGTCCAGGACGCGAGAAGCCACTGATGAGAGCTGGG
AAAGTGGTGGACCGTCGTGCCGCGCTCAACACCGGTATGA
GCCACCTGATTTTGGAGAATGTTGGAGAAAGCGACGAAGG
AGTTTACACCATCACATCCAACCAAAACACAAAGGAAGTT
ACAACCATGAAGCTCTATATTAGAGACTGCTCAAGTGAGG
TCAAGGTGTATTATGGTTTAGATTTTCATGTTTCACTGAA
TGATATATCACAGCCGTTGCGCATCGGCTTTCGCCACAGT
GCAGTGGAGGCCAATCAGACGTCACTGCCTGCTGCCAACC
TGCTAAATGATGATGGGACGCCCAAGGAGACTTACCAGGA
GCGGCTCAAGATCGATCCTCAAAAGTTCGTTTTGCGTGCT
GTCACAGGGGCTGATGAGGGCAGTTACACCTTCAGTGATT
CCAATGGCAAAGTCAAGAAGAAGATTTGCCTGAATGTGAA
AGAACATCAGGTATTTGAACCCGTTTCATACGGTGACACT
GTGAAAATAAACCTGCACTTGAATAGGTCTTTAGTCCGCC
TGAACTACACCCCTGAGTCCGATAAGCTCAAGTATTTGAT
TATGGAGAGCGGAGAGCTCAGTGTGCCTCCTAACCTGGAC
CTCGAGGGTCGCCTTACTTTGGAGGACTCTGTGTGTGTCC
TGACGGATGTGAAGGCCAGCGATGCCGGTGTTTTCAGTGT
GACGGACCTTCAGGGATTCTTGGTGTCTGAGTTCCACCTG
AGTCTGAAACCCTACAGTATTCCAAGACTGTACATTGCCA
TCATCGCTCTGGTAGCATTATTGGTGTTGCTGCTGTTGGT
GTGCTTGGTGTCGTGTTTGGTGAAGATACGCAAACGTGCA
GCAAAGGCCAGAGCCATTGAGGAGAAAGCCCAGAATGCTG
GAAAAGTGGAAGGAGATGCCTTCAGACAGGTTGTGAAAGA
CGCCTGTACCCGTCAAAATGAGGAAGCCCCAGCCCTATCA
CAGAAAGAAGACATTACTGAAAAATCACAGAGCACAGAGG
TCAGCATTAAGGGTTTGGAAGTGTCTACAAAAGAGCCAAG
TCTACAAGAGAGGAATATGGAGACCAGTGACTCTGGAGTG
GGCTTTAATACCACAGGGCTCCCGCTTGACAGTGACACAG
ATGCCCCAACAGCAGCCATAGCAGATTCTGATGTTTTAAG
TTCCTCTGCTGCCCCGGAAATCAAAGCTGTTCCCAACCAA
ATTCCAGAACCAAAGACGACCCCCTCCCCTCCAAAACCAG
CATCAGCTTCTGATCTCAAACCAACACCCGTGGTCAAGTC
AACAGCTCCTCCACCACCTTCTCCTGAACCCAAGCCTCCA
GTAACACCTGAACCCAAACCTGCAGTCACACCAACACCTG
AACCCAAACCTGCTGCTACACCTGAACCAAAAATGACCAT
CTCGCCACCACCTGAAACAAAACCAACCTTAACCCCATCA
CCTGAACCCAAACATCCTGTGATACCTGACCCAAAACCAA
CAAGTCCGGCACCTGAGGCTAAACCAATTCCAAGCCCAAC
TCCTGAACCTCCAAAAGCAGTAACACCAACTCCTGATGCA
AAACCAGCCATTACTCCAGATGCCAAACCAGCTGTTTCAC
CTACTCCAGAACCCACACCAGCTAAAATTGGCACTCCTGA
ACAGAAACCTGCTGTGAGCCCCACACCTGGTCCCAAGACT
CCAGATCCTAAAGCAGTTTCTCCAGTCCCTGAGCTTAAAC
CAACTTCGCCCACTCCACAGTCTAAATCACCAATCTCACC
AATTCTCGACTCAAAACCAACTACAAATGGCACTCCTGAA
TCCAAGGCTGAATTAGGATCAGAGCCAAGTGCGCCCCTGT
CTCCTGGGCTGGATGTGAAGGGCACTACCCCTCCCAAAAC
CCCTGATACCGGGAAAAGCTCAGTTAAAACTCCTGAGCTC
ATCTCCACTGGAGGTCTTGACTCGGCTTCAACCAATGACA
GTGCACCGCCTCCAAGCACCGATGGAGCGGCCACCAACTG
AGATTAAAACCATAGCCTCTTCCTGCCTCCTCCTAGTGTA
TTAACCACCACAGACAATCGAGACACTTGTCTTAACAACA
AATAAGAGCTAAGTGACTTCCTAAGGAGGTGGGGTCTTTT
GAGTCTCACTTTTAATACGATTAACATGCATCAATAGAAA
GATCCACTGTAAATCCACTCAGTTTACTAATATTTAGTCA
CCACATAAAAGGGTTTGAATACAGAGATGAAGCACTCCAG
ACCCTACACTATTGGCTGATTTAATACAGAACGAGGGAGG
CTGTTCCAAGAAAGTGTACAAAGACAAATGTTCCTTCACA
GAAATAATACATCACTGCATGAAGATATTGAAAAAATAAA
TGATATTATCAGTTCTGTAATCCAAGATTACTACAGTTGA
ATTTGGGGAAGGCACCCAGGGGCATGGGACATTAATCATT
TTCATTCTATACGAAATCATTTCTGCTCCATTTTGAAAAG
TTAGAGACTCCGAATTGCAGGATTGATACTGAGGAAGCAG
TGTGGCAAGTTTCTGCTATTTATGGACTGGAAAATGGAAA
CGCCTTGTGTCACTTTGACACATGCAAGTCAACGTCATTT
TGACAAGAGATAAACTAGGCAACTCCTAGAGTAAAGTGCA
GTGCAAAGCCAAACGAAGAAAATCCATTTGACCAAAAACA
TCACAATCCTTCATAGACTAATCTGTGACTTTGTGCCTGG
AGGACATTTTTGAAAATCTTCTTCTATCAGTCCAACCTAA
GACACAAGCTGTTCTTATCCAGAGATGTGACTGACCACAT
TTCTGTCCATTCAGTAACAAAAATATTACTGTGGAAATAT
TCCTCAATTGTTTCTGTGAGCAAGATCCCTTCATACAACT
GACAACCTTGTCGGCAACAGGTACAAGTTACTTCTTTGAG
TGAGTTGTTTTCAGACTAATCGATCTTGATGGGGAGGCTG
AAGGACCCAAAAAGATGTTATATAAATCAGGTGTTGACAC
ATGTACACCCAAAAAGTCTGCTGATTCCCATCTTACTTCC
CAGAACTGAGTTGTCAGTTGTGGAGAATGTGGCAGACTAC
TGCTACATGGTATAGTTTTACTGGCACCTTATGCCAAGGT
CAGACTGCAGGATTTTTAAAGTAGTTGTGTCACAGATGTT
TT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-77h1.4-201 Contained in:

OTHER si:dkeyp-77h1.4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037190 (1)
  • Ensembl_Trans:ENSDART00000081092 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090751 (1) 1860 bp
    GenBank:CK703592 (1) 382 bp
    CITATIONS (2)