header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17438
Transcript Name: meox1-201
Previous Name: meox1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037000 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037000|OTTDARG00000027497|ZDB-GENE-040718-149 meox1|OTTDARP00000029659 DKEY-102M20.1-001 LG_ CR847827.7 Danio rerio protein_coding KNOWN, 2771 bp
GAATGTCTCCGAGCTGTGAAAAGAGTGTGTAGAGCTGCGA
GTGGATGTAGTGGGTCAGCCTGCACACCAAATGAGAGACT
GAGAGCTGATGTGTTATGCCAAGGAAAGGCCGCATCAGGA
AGGTCTTTGATTTCCTAGTTGTTCTGCAAAGGAGGCACAT
GCTGAAGTGGATATTTCCCAACAAGCTGCATCCTTGAGGA
CTCCACTAATTCTTCAGTATGGAACAGTCAGCCAGCAGTT
GCATGCGGAGCCCTCATACGGGTGGCGCTTTATGGGGATG
CGTCAGGAGTCCTCATTCGGGTGGCTCCGGAGCCGGGATT
CAGCCTTACCAGCAGGCCCCGTTTGCTCTGCACCAGAAGC
ATGACTTCCTGGCCTACACAGACTTCTCCAGCTCCTGCCT
GGTGCCAGCGCCACATGCGTACCCTCGGGAGGACAGACTC
TATCCGGAGACGCACAGCGGGTACCAGAGGACAGAGTGGC
AGTTCTCTCCATGCGAGCCCAGAGGCAGAGGGCAAGAGCC
CTGCCAGGGGGCGGCTGAGGCAGTGGGAGCTGAAATGGAC
AGTGCAGGGGGAGACAGGCTGGCTGGAGCAGTCACTGGGT
GTCTCGAGGGAGACTATTCACCTCAAAGTGTGCCTGCAGT
CGACACTGAAAAAAAAAGCTCCAAGCGGAAAAGAGAAGTC
ACAGATATTCAGGACTCGAGCTTCAAGGCAGACTCGAACT
GCAAGGCTAGAAAGGAACGAACGGCTTTTACCAAAGAGCA
ACTCCGAGAGCTGGAAGCCGAGTTCACCCACCACAACTAC
TTGACTCGTCTTCGCCGCTACGAGATCGCAGTCAACCTTG
ACCTCACTGAGAGACAGGTGAAAGTGTGGTTTCAAAACAG
ACGGATGAAGTGGAAGAGAGTGAAAGGAGGACAGCCCGCA
TCTCCTCACGACCTTGAAGCAGATGAGCTGGACTCGGCCG
CTTCGCCCAGCTCTGAGTGAAAACCCAATCTAGACATTTG
CTCATATTTACAGTCACCCCGGCCAAATGCAGTGTCCAAT
TTTTCACTTGTCCTTCCACGTATCCTGTTTCACTGCTTCG
TGGACAAAAGCGTCCGTGCTTCCTGTTGCTCTCTTCACTC
AGATGACTAATTATCAACAGAGTTTCAACAGCTTGGAAGC
ACCATCCACTTTCAGTCCACATGTTTCACTTTCATTCATA
AACAGATCGAGTGAAATCAGAGGCCTATAAAAACTCAATT
ACTCACGTGTAAAAACAATTTATATTAACTGTTCAAGCCC
TGGTTTAATAGCTTTGACCTCCAGCCATGACGGCATGATG
TAGGTCTTTTACACTGTGGTGGTGGTGCCTGAAGCCTGAT
CAGAACCACCTGTGAAGCTCTACAAACAGACGGACGGTTT
CAGGATCACACCAAACCACTAGAGCATCGATATTGTGTCT
TTATTTTTAGCCTAAATTGTGTTTTCAGGTTAGAAAAAAA
AAAGCTTTCTTGAATTTCTTCCAATTTTGTACTTCTCTTT
TTTTTATATAAAACTAATAAAGCAGAGATGTTGCATAAAA
TGAGAAAAAAATAAATTTTTTAAAAACTGATTTAAAGAAA
AGATTTCTGCTTTTATTTAAACTGGAAAACAAACACTGTT
ATACTGAACTGGTGTGAAGGTAAAATTATGGGAAAGTAAA
TGATAATAATGTAAACTTTGTTAGCTCAAATCACTTGTGT
GTGCTTTTAAACTATGTGATATTTAAACTATGTTTGCACA
ATGCAAATTCTGTTATCATTTATGGTGAATTTACACTGCA
CCATCTAAAAAGTGAAGCCTGAATTAGTCCATGGAGGCTG
GCTGCAGTATAGGTCAAAAACCTCACCTACTGTATGTAAA
TGAATGTGAATAAATTGTATATAGTGTATGTGTGTGAGTG
AGTGTGTATAAGTGTTTCCCAGTGTTGGGTTGCGGCTGGA
TGGGCATTCACTGCGTAAAACATATGCTGGATAAGTTGCT
GATTTATTTCATTGTGGTGACCCCTGATTAATAAAGGGAC
TACGCCGAAAAGAAAAAAAAAGAATGAATAAGGGTGTGAT
GAGATCTCATATGACAAGATTTCTCGTCAAGGTGAAAAGT
CTCTTGAGTTGTGATGTCATGATGAACCATAAGAGTGAAT
TTAGCATTGAAGATTGGCGGTAGGATTAGATTCAAACCTC
AAATCAAGCCTAAATAAAAGACGGTTATATATTTTCCAGT
TATATATTTCATTATTGAAGATTCAATGTGTAAAAATCTC
ATCTTGTTCTCTTGAACTCAATTTCAATCACGAGTCTCGT
TTCATCATGGAGTAAGCATCTCAACACACCCCTAAATTCC
ATGCATGCACACACACATACACAAAACTGTCTGTCTATCT
AAAGTCACTTTTGCTCTTTATTATATTTGAACTAAATCAC
TAAACTAAAACTATTTCACTAAAAGTCAACAGCAAATTTA
TTGAAAATTATTAAAACTGGATTAAATATGCTTGTGAAAT
AGTTTGAGTTTGCATTGAACTGTTCATTAACAATCAATGT
TAAGGGATTTTTTTATGCAGTTTAGATAAATAAATGGATA
TTTTCACTTTTCTACAGTGGAAGTAGAGATGTGATGTTCG
TCCTTTTAAAACAGTCTATGTCACACATACATGCCAACCA
ACCGCAAAAAAATGCTTTGATGGGCTTTAGTCAGATCACT
GTGTTATTCATGTCTGTGCTGGCTGCTGCCAATTAAATGT
TTTAATTGCCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
meox1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037000 (1),  Ensembl_Trans:ENSDART00000105661 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH455151 (1) 893 bp
GenBank:CT635150 (1) 791 bp
GenBank:CT717410 (1) 785 bp
GenBank:CT674163 (1) 766 bp
GenBank:CT616588 (1) 761 bp
GenBank:CT634943 (1) 529 bp
GenBank:CT643663 (1) 266 bp
CITATIONS (2)