Transcript

tut1-201

ID
ZDB-TSCRIPT-090929-17328
Name
tut1-201
Previous Names
  • tut1-001
  • zgc:112254-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036883 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036883|OTTDARG00000027426|ZDB-GENE-050706-68 tut1|OTTDARP00000029570 CH211-250B22.4-001 LG_ CR848037.16 Danio rerio protein_coding KNOWN, 2774 bp
GACGCAACGGAACATCATGGAGGGAGATTTGACTTGTGTT
TTGTAGCTCAGACTCTTTCCTTCAAAGTAGCAGCACAGTC
TCTCAATGGAGCTCGACAAAGACATCCAGACAACTCAAAA
GGGATTTCATTGCAACCTCTGCCATGTTAACATACCTAAC
AGGCCCAGTTTGGAAGATCATGTTAAAGGAAAGAAACACC
TGCATCTCCTGCGCCTCAGAGCTCAGCGGAAAACTCAGGA
AGAAAACAGTGTGTTTGTGAGCGGCTTTAAAGCAGACACG
TCTCAGACTGAGCTGAAGGAGTATTTCCAACAGTTTGGAC
TGGTGACGGATGTGATCATGGACAAACAGAAGGGTGTGTA
TGCCATAGTTGAGTTTTCAGAGTCTCAGGATGTTCAGACA
ACTCTGGCACAACCACAGCATCAGCTAAATGGACTCAAAC
TCCGTGTCAAACCCAGAGAGAAGAAAGAGTTCAAGCTGGC
CAGCAGAGGGAAACAAGACTGCAAAAACACCCTGATCAGC
CTGGACAAACTCAACTTTGAGCTCTGCAAGGCTATGTCTG
TAAATGAGCAGATACAGAAAGTAGTCGAGAGTTTGGAGCT
GAAAGACAACGAGAAGAAAGTGAGAGATCTTCTAGTTCAG
CTGCTGCAGGAAGTTTTCACAGAGTTCTTTCCAGATTGCC
AGATTGTGCCCTTTGGCTCGTCTGTGAACACCTTTGGGCT
TCACTCCTGTGATCTTGATCTGTTCCTTGACCTTGAGAAC
ACCAAAGTATTTCAAGCTCGTGCAAAGTCTTCAGAACAGA
CAGGAGAGAACCAGTCCGAGGATTGCCGTTCTGAAGACTC
CATTTTGTCTGACATTGACCTGTCCACTGCCTCTCCTGCT
GAAATTTTGGAGCTGGTTGCTGTTATTTTGAGGAAGTGCG
TTCCTGGTGTTCACAAAGTACAGGCGCTCAGCACTGCTCG
ACTTCCTGTGGTCAAGTTCAGTCACAAGGAGCTCAACCTC
CAAGGAGACATCACCATCAACAACAGATTGGCAGTAAGGA
ACACAAAATTTCTGCAGTTGTGTTCAGGTATCGACTCCAG
ACTCCGACCCTTAGTCTACACCATCCGTTTATGGGCTAAG
CAGAAACAACTAGCAGGAAACCTGTCTGGCCCGGGTCCGT
TGTTGAACAATTACGCTCTCACACTGCTGGTGATCTTCTT
CCTTCAGAATCGAGACCCTCCTGTGCTTCCTTCTGTCAAT
CAGCTCAAGAACATGGCCTGTGAGGAAGAGGAGTGTGCTA
TTGAGGAATGGGATTGCACATTTCCTAGCCAGCCCTTTAG
TGTACCGCCCAGCAAAAACACTGAAGATCTCTGCACTTTG
CTTTTTGGATTCTTCACCTTTTACTCCAAGTTTGATTTCC
CTGCGTCAGTGGTGTCTCTGAGAGATGGCCATGCGCTGCC
TATCACAGACTTCCTCAAAAGTGACATGGAGGCGTTAAAA
ACTGCAGATGCCTCTAGTCCCAAACCAAAGCGTTCTTCAG
CTCCAAGACTGGGCCCTATGAATGTCCTTGATCCATTTGA
GCTGAACCACAATGTGGCAGGAAACCTTAATGAGCGAACG
CAGAAGAACTTCAAGAGGGAGTGCTGCGAGGCTGAGAAGT
ACTGTCGCAGTCTGCAGTACCAGCGCAAATCAGCCAAGGG
CAAATCCTGGGGCCTCGTGCGACTCTTTGCACCGCAGAGT
GAAGCTGCAGCCTCTTCACAGCCCAGAGCTGAGAAGGTTT
TGGAGGTCAGCGTCCCTTTCAAGCCAGCCAGTCTCCCAGA
ATCCTTGCGTGCCCAGCTGGCTTCGGCTGGGAAGGATTTT
CGGGGGCTCTGGTTTGCCGAGGTCTGCTCTGCTGTGCATA
AGGTGTTTAATAAAATCTTACAGTGTTCACCCACAGAGGA
GACTCAAAGTTTGGACAAAACCGATAAAAGTGGAAGTGAA
ATGGAGGTAAATAATAACAGGAGTCTAGAAGATACTAACA
TCCAAGTGAAAGGTGAGGCTGGTAAAAAGAGGCCTCTTTC
AGTGGAGGAGGGTCCATCAACCTCCACCATTACACAAGCG
AAAAGACAAAGACTAGATGTTGACCTGGAGCACCCAGAGC
CACTCCACTGGACTTGGACTCAGAGGAGCCGTGTTTGGGC
AGGCCGGCGGAAAGTGCGAAGAGATCTCTTGAAGACCAGC
GATGAGGCATCCAAACCTGAAGGAGGCTGTGTGGATATGG
AGAGCAGGGTGACGCAGAGCATTGTGGAGAAAGAGGAGAA
ACTTCACGATTCGTTGGAGTTCAAAGTGGACGCTGAGGTC
GTTGGAGGGAATGAAAGCACTAAGGTTGTCCTCCGTTTCC
ACCCGAGCAATGATACTGCAGGCGTCTTTCAAGATTTCTT
CCATTTTCTGGAGTCCTTCCTGCCTAAGATGGCAGAGACG
ATCATGGGCAGGGCAGAGGACATTACAGATATGTCGTAAT
TTAGTTTTTTGTTTGTTCAAAACTTAATTTGATTAAAATC
TTTATAAACTTGTGATTTTTTATGTAAAGCTTAAAGATTG
ACTTTGTAAACCTTCTAAAAAAGATGTTCTGAGAATATGA
GAATATGAGAACATACATGCTTTTGTTTTTGCATGTTTTG
ACTTCAGATTTGTTTCCTGTTTGAATTAGTTGACTTTTGT
TTTATTCCTGATGATTTTGGCATGATTGCCTCTATAATGT
GTATATAATTAATGTGAACACTCACATTAAAACTGACGGT
TTGTATGATTGAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations