header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17303
Transcript Name: vps33b-201
Previous Name: vps33b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036857 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036857|OTTDARG00000027411|ZDB-GENE-050327-73 vps33b|OTTDARP00000029546 vps33b-001 LG_ CR382298.22 Danio rerio protein_coding KNOWN, 2634 bp
TCAGCCGTCATATAGCAAACCCACTTCCGGAAAAGGTGTT
CGAGCTGTCAGGATCTGTCCATATGGCTCAGACAGAGAGG
AGAGATGCTCCTGAACTGCCCGACTTCTCATTGCTCAAAA
GACTGGCAAGAGACCAGCTCATCTTTCTGCTGGAGCAGTT
GCCAGGGAAGAAGGATTTATTTATTGATGCAGATTTGATG
AGTCCTCTAGATCGAATTGCAAATGTCACAATCCTAAAGC
AACATGAAGTCGACAAACTATACAAAGTTGAGCTTAAACC
AATCGTCAGCAGTTCAGACCAGCTGTGCTTCCTCATACGT
CCTAGAATACAAACTGTGAAGTGGATTTCAGATTTAGTTA
ATTCAGACAAGGTAGCTGGACGATTCAGAAGATATAAGAT
CATATTTACCCCACAAAAGTTTTATGCGTGTGAAACAGTT
TTGGAGGAACAGGGTGTCTATGGAGATGTTACAACCGATG
AATGGAATTTCTACATTCTTCCTCTGGATGACGATATCCT
CAGCTTAGAGCTGCCAGAGTTCTTCAGAGATAACTTTCTG
GAGGGAGACCAGCGCTGGGTGACCACTGGAGGGGGTGCTT
TACATCTTTTACAGTCTGTCTATGGTTCCTTCTCAAAGGT
TTATGGGATTGGAAGATGTGCCAAGATGGTGTATGAATCC
TGGAGGGAACTAATGGAGGAGGGTGAACAAAGAACAAGAC
AACCTGAATTTGCCAAAGTATTTCTTATCGACAGAGATGT
GGATTTTGTTACTCCTCTCTGCTCTCAAGTGGTTTACGAG
GGATTGGTGGATGACATTTTCAGAATAAAATGTAGCAGTG
TGGAGTTTGGCCCTGATGTCACTTCCTCTGACAAGAGTAT
CAAAGTGATGCTTAACTCTCAAGATAAAGTGTTCAATGAA
ATAAGGAATGAACATTTTTCCAATGTGTTTGGCTTTTTAA
GTCAGAAGGCTAAGAATCTTCAGACAGCATATGATAAACG
GCGTGGGATGGACATCCAGCAGATGAAGGCGTTTGTTGCA
GATGAGCTGAAAGGACTCAAACAGGAACATCGTCTTCTTA
GTCTTCATATTGGTGCAAGCGAATCCATAATGAAGAAGAA
AACGAAGCAAGATTTCCAGGAATTGTTGAAAACTGAACAT
TCATTACTTGAAGGCTTTGAGATCCGGGAATGTATTGCTT
ACATTGAAGAACATATCAACAGACAGGTGTCGATGATTGA
TAGCCTTAGACTCCTTTGTCTGTTGTCTATCACAGAAAAT
GGCCTTCTGTCCAAAGACTATCGATCTCTTAAAGCTCAGT
ACCTTCAGAGTTATGGTATAGAGCACCTGCTGACGTTTGC
AAACCTGAGGCAGCTGGGACTGTTGGAAGAACAGCAAACT
GGAGAAACACTGACAGTCATGGAGAGTAAAGTAGGGAAAC
TTGTCAATGACAAGACTGCAGGGAAGCTGACGGATGCCTT
CTCCTCACTGGCTAAGAAGAGCAATTTCCGAGCTCTGAGT
AAAAGACTGGCTCTGGTGCCAAAGTCTGGTGAGGAATATG
ACCTTCGCGTTCCACGAGACATGGCTTATATTTTCAGTGG
TGCTTACATTCCCCTGAGCTGCAAACTGATTGAACAGGTG
CTGGAGAGAGATGGGTGGACAGGTCTGGAGGAGGTCACAC
GCATGCTGAATGGACAGGACTTTGCTGTAACAGGTGGCAG
CAGTAGTTCAGAAGCCAGGAACAAAAGTAATGGTCAAAGG
ATCGTCCTAGTGATGTTCCTTGGTGGCTGCACTTACTCTG
AGATCTCCGCACTCCGATTCCTCGGCAAGGAAAGAGGTTG
CAGATTCATAGTGCTCACAACAGCCATCACCAACAGTGGA
CGGCTTCTGGAAGCTTTACTGGATAAACATGTTTGAGTCA
ACATTCCGCAGGAGGACGCTTTATGACCAATTTCAGGACT
GAGCACGAAGGACAGAATACATCCTGATTGTCTTTGACAT
CAGAATCACCTCTAAACACAAACTATTTTCACAGGGGATG
AAAATACCATTAAAAATCTGCTATATCGTTTATCCCCTCA
TGTCATTCCAGACTTGTTTTAAGGGATAGTTCACCCATAA
ATAAGAGTTCTGTCATTGTTTACTCACCCTTGTTTTGTTA
AAAAACTGTTTTTTTTTTGTTCTGTTGAGGGAAAAAATAC
TGTGGAAGTCAGGGGTTTTCAACATTCTTCAAAATATCTT
CTTTTGTGTTTAACAGAATAAAATATTCAAGCTAGTATTG
AACAAGTCAATTGTGACTAAATTTAAATTGAACCATCCTA
TTAACTGTGTTTCTTCCATGGAACATACAATCTGACATTT
TGTAGAATGTTTGTCTTGATAGAAACTTTATGGAACAAAA
CACAGAGCCAGCTCTTAATATATATTTTTGAGGTTGAGTA
AATAATGACAGGATTGGCATTTATGGGTGAACATCTATCC
CTTTAATCGTCCACACAGGTGTCATCTGAATTTATGAACA
GAAAAGTGTCAAATGTGATACAGTTCTGCACTTTATAAAA
ATGTTTGTACTCTGTTCATAGTGTGCAGATTCAAGACTGA
ACATTAAAGTTACTGCTGTCCGCTGTGACATTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps33b-201 Contained in:
[BAC] DKEY-25J19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036857 (1),  Ensembl_Trans:ENSDART00000065868 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC091824 (1) 2665 bp
GenBank:DQ230986 (1) 1917 bp
GenBank:EB952665 (1) 400 bp
CITATIONS (2)