ZFIN ID: ZDB-TSCRIPT-090929-17296
Transcript Name: aldh18a1-201
Previous Name: aldh18a1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036850 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036850|OTTDARG00000027405|ZDB-GENE-030131-5602 aldh18a1|OTTDARP00000029540 aldh18a1-001 LG_none CR354534.16,CR751608.20 Danio rerio protein_coding KNOWN, 4416 bp
GTCAACATGGCTGAACCCATGCGAGCAGCTGTTGAGAGTT
GATGTGGCATCGAAGAACAGCAGTGGCAGTGAACTTGAGC
TGAATTATTCATATTTATTGCACAGATTAAGATCAGATCA
CCATGTCTCTCCAGAGGATGTTCTCCTGTTCGCGGCTTTT
AGCAAGACCAAATGCTCTGCAAACATTCAGGCGAGCAGCT
TCACAGGGCAAAATGCCGCTGGCACGGGCGCATGGTAAGT
CATTCGCTCACCGGAGCGAGCTGCGCCAGGCCAAGAGAAT
CGTCGTCAAGTTGGGAAGTGCTGTCGTAACCCGAGGTGAT
GAGTGTGGCCTCGCTTTGGGCCGACTCGCTTCAATCGTAG
AGCAGGTGGCCATGCTTCAGAATCAGGGTAGGGAAATGAT
GATCGTGACCAGTGGCGCTGTGGCATTTGGAAAACAAAGG
CTGAGGCATGAAATACTTCTCTCACAGAGTGTCAGACAAG
CCCTGCATTCAGGCCAGAATCAGCTCAAAGACATGTCATT
GCCGGTTCTAGAGGCGAGAGCTTGTGCCGCTGCAGGACAG
AGTGGCCTTATGGCTCTGTATGAGGCAATGTTCACTCAGT
ACAGCACTTGCACGGCCCAGATCCTGGTAACAAACCTAGA
CTTCCACGACGAACAGAAAAGACGAAACTTGAATAGCACT
CTGTACGAGCTGCTGCGAATGAACATCGTTCCCATCATCA
ACACCAACGATGCCGTGGTGCCTCCCCCAGAACCCAACAG
CGACCTACAGGGGGTAAATGTTATCAGCATTAAGGATAAT
GACAGTCTTGCTGCAAGGCTTGCTGTGGAAATGAGGGCAG
ATCTCCTTATTGCTCTCTCTGATGTAGAGGGCCTTTATGA
CAGTCCACCAGGGTCAGATGATGCCAAGCTTTTGGACACA
TTTTACCCTGGAGACCAGCAATCAATAACCTATGGCACAA
AGTCTAGGGTCGGCATCGGAGGAATGGAAGCCAAGGTAAA
AGCTGCTCTCTGGGCTCTCCAAGGAGGAACGTCTGTGGTC
ATTGCTAACGGTACACACCCCAAAGTCACAGGTCATGTGA
TCACTGATATTGTTGAGGGCAAGAAAGTGGGAACCTTCTT
CTCAGAGGTCAAGCCAGCAGGCCCCACGGTGGAGCAGCAG
ACAGAAATGGCTCGCTCTGCTGGCAGGACTCTTGCTTCCC
TTGAACCAGAGCAGAGAAGTGACATCATCTGTGCATTGGC
TGACCTTCTCACAGAGAGGAAAGAAGAAATCCTGTCTGCC
AACAAGAAGGACATGGAGAACGCTGTCAACACGGGTCGCC
TGTCTCCAGCTATGCTGAAGCGGCTTAGTTTGTCATCGTC
TAAGCTGAACAGTCTGTCCATCGGTCTGCGTCAGATCGCG
GTGTCCTCTCAGGACAGTGTTGGCAGGGTTTTGCGCAGGA
CTCGTGTTGCAAACAACCTGGAGCTGGAGCAGATCACTGT
GCCCATAGGAGTACTGCTGGTCATCTTTGAGTCACGGCCA
GACTGCCTGCCTCAGGTTTCTGCATTAGCCATTGCCAGTG
GAAATGCTCTTTTGCTGAAAGGTGGCAAAGAGGCGGCCAA
CACCAATCGCATCCTGCATGAGCTTGCACAGGAAGCCCTG
TCTATACATGGAGTCAAAGATGCCATCCAACTGGTGAGCA
CTCGTGAAGAGGTGGAGGATCTGTGTCGTCTGGAGAAGAT
GATTGATCTGATCATTCCCCGTGGCTCCTCGCAGCTGGTC
AGAGATATTCAGCGAGCAGCTAAAGGCATCCCTGTGCTTG
GCCACAGTGAGGGGATCTGCCATGTCTATGTTGACCACGA
GGCCAGTATTGACAAAGCCATCAAAATCATCCGAGACTCT
AAATGTGACTACCCTGCTGCCTGCAACGCAATGGAAACTC
TGTTGGTGCATCGAGATCTTCTCAGAACTCCAGTATTTGA
TCAAATCATTGATATGCTGAGAACAGAACAAGTCAAGATT
CACGCTGGCCCTAAGTTTGCATCCTATCTAACCTTTAGTC
CATCAGAAGTGAAGTCTTTGCGTACAGAGTATGGAGATCT
GGAGTGCTGTATCGAGGTGGTGGACAGCATGCAGGAGGCT
ATAGATCACATCCATAAATATGGCAGCTCACACACTGATG
TTATCGTCACTGAGAACGAGAACACAGCTGAGCAGTTCCT
CCAGCAGTTGGACAGTGCCTGTGTCTTCTGGAATGCCAGC
TCACGGTTTGCTGATGGATATCGGTTTGGCCTAGGTGCGG
AGGTTGGCATCAGCACTGCCCGTATTCATGCCCGTGGTCC
TGTGGGGCTGGAAGGGCTTCTCACGACTAAGTGGGTGTTG
CGGGGTGAAGGCCACACAGTGGCAGATTTCTCGGAGCATG
GCAGCATGACGTATCTGCATGAAAATCTACCGGTGGCACA
GCTCCTTCCTGGATACAGAACCACCAGCTAGAGTTGAGAA
GTAAATGCTTCTACGCTCAAGGATCAAATGCATATCACCT
ACTTAAATCCCATTTAAAGACTCCTGTCAGGCAGTGTGTT
TGGAAAATCAAATGTGAATGGGCAGTCAAACCGATGTATT
TTAAGGGATAGTTCTCCAAAAAAAAAAAAAAGTAATTTAT
TCTCCCTCAGGCCATTCAAGATGTAGGGGACTTTTTGTTT
AGTTGCTGATCAAATAAATTATAATACTAAATGCATTAAA
AATACATATAATAAATACAATAAATTATATAATTATTTGA
GCTGAAATTGAAAGTGCTAGCAGCCATTGATTTATATTAA
TCTTCCCATAGTTAAAGACATGCAGGCACAACAAAATTAA
TACCCATTGTTTCTGATGGTACGTTGAGGTCTAATCCATT
TAAAATAATTAGTCTATTCAAGGAACTGAGCATTATTTGC
AAAACTTTCATTTATTCACACGATTTTGCAAGCACTCTTG
AGCATTTATAATGATGGGCAATGGACAGATGCAAACAAGT
TGTTAGCAATGGAAAGAAAGGTCGTGTGAGTACATATGCT
GAAACTTGTTGAAAGTTAAACACCTGCACACATCCTTACA
ATCATTATGACTGTACTCTGGACTATTTTCTGCACCTACT
ATTTTAATAATGCTCAGATGCATCATTTTGCTTCATCAGA
TTTAAGTGCATCGTCAGGAGCCACGGGTACTAGTTTAGTT
TTGCCTGTGTGTGGTATTTAACTCTGAAAATGCCAACTAA
TCGTTTAATGTTCTACTAAAGAAAAAAACTCACCTACATT
ACATATTGAATTTCCTGAGGGTAAAATAGTAGCATTTATT
TTTTATTTTTGGAGGTGTTCTATCCCTTTAAGAAGCCTTT
AAAGCATAAGTCTCAAACACAATTCCTGGACGGCCACAGC
TCTGCACAGTTTTACTCCGACCCTGATTAAACAGCTGATC
CCACTAATGAATGTGTTCAAGACTCTTTTTAAACGCCTCG
ATTATTTGGATCAGCTGAGTTTGATTAGAGTTGGAACAAA
ACTGTGCAGAGCTACGGCCCTCCAGGAATTGTTTGAGACT
TCTGCTTTAAAGGCTTCTGTTTGTCCCGTACTTTAGATTC
TCTCAAGGGCCAAAGAGATCACCTCAACTTATTGTTAAAT
GTGTCTTGTTTTCTTTGTAAATCGGTTGAACCTAGCTACT
AAACACAGTTAATGGTACACAGATGGATAAGGGATTTTAG
TGCTGGCTATGCTCATGTTGTCATTTTATGATTTGTGCAT
ATTTTCCTTTAAGTATCCAAATGTATCATGATCACGATGA
ATGCAATGACACTTCCCGACCTCCAGAATTGCCAATGTTA
TATTTATGTAATATTTAAGAATAAAATGTGGTACAATAAT
CCTTTACAGTACAATAATCCTTCAAATCATAGCATTAAAT
AAAATGTGTATTACAAGTATGGCAACATTGTGTACCCAAC
TTCAGGTTTAGAGAGTAAAGTATTTTTTTCATATGGTATA
GTGATCTCAAATAGAATATAACATGAGTACTAACTGAAAA
AGGTAACCATAGAAGAAAATAGTCATGTTACCATAGTGTT
CAACCTATCCAATTCAACATGGGAAAACTGTATTATTAGC
TTAAATCATCTGTATGCTGCTTTTGAAAAGAAAACGAATG
GAAAATCAGTTTTCCTGTGCATCACTTCTCTCATTTTGCG
TAGTTCTTTAGCTTTTTAATCACAAATACTGTGCAAATCA
TTTCCCTGCTGTAAAATTCACCCGGGACGGGCACATTTTG
TCCTGAACTGCTGCAGAAATCCTCATTATCTGTACTTAAA
AGTGCTGTATCGCTTCACTAAATAGTGATGCTCGCAGTGT
TCTGAAGATGTTCACAATTTTTGTATGTAGAATAAATGTC
TTTTTGTACTTTCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aldh18a1-201 Contained in:
OTHER aldh18a1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036850 (1)
  • Ensembl_Trans:ENSDART00000160422 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC135033 (1) 2624bp
    GenBank:BG799672 (1) 565bp
    GenBank:BI673388 (1) 558bp
    GenBank:BQ092311 (1) 524bp
    GenBank:BM530888 (1) 179bp
    CITATIONS (2)