header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17190
Transcript Name: rbm4.1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036744 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036744|OTTDARG00000027353|ZDB-GENE-030131-3902 rbm4.1|no_translation rbm4-002 LG_ AL928799.13 Danio rerio protein_coding KNOWN, 580 bp
ATGCGACGCAACAGTGACGCCATTTCATCTCGCACCGGCT
TCTGCAAGCATTGTGAAAAGATCCTGAAATTTGAATTTAC
ATTATTAAAATGGTGAAAATCTTTGTTGGGAACCTCTCGC
CGAACACTACGGCTGAGGAGATCCGTTCCCTCTTCTCTCA
GTATGGCAAGATCTCAGAGTGTGACATTGTGAAGAACTTT
GGCTTTGTGCACATGGATAGCAAATCGGAGGCAGATGAAG
CCATTCAAAATCTTCATCATTACATGCTGAATGGTATGGC
CATGAATGTGGAGATGAGCAAAGGGAAACCCAAGACCTCT
ACAAAACTCCATGTGGGAAACATCAGCAGTAGCTGCACCA
ACCAAGAACTCAGGGCCAAGTTTGAGGAGTACGGACCTGT
GGTTGAGTGCGATATTGTGAAGGACTATGCTTTTGTTCAC
ATGGAGCGAGTGGAAGATGCTATGGAAGCCATCAGTGGCT
TGGACAACACAGCCTTTCAAGGTGAACCAGTATGGTCCTT
TGACCTGTTTAAATAAAGAAAAATAATATTATCTTGTTAC
ATTACCAAAAGTGAGCATTT

rbm4.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rbm4.1-002 580
mRNA rbm4.1-201 (1) 1626
rbm4.1-203 (1) 753
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbm4.1-002 Contained in:
OTHER rbm4.1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036744 (1)
  • Ensembl_Trans:ENSDART00000148054 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH594233 (1) 593bp
    CITATIONS (2)