header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17189
Transcript Name: rbm4.1-201
Previous Name: rbm4.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036743 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036743|OTTDARG00000027353|ZDB-GENE-030131-3902 rbm4.1|OTTDARP00000029469 rbm4-001 LG_ AL928799.13 Danio rerio protein_coding KNOWN, 1626 bp
ATCATGCGATTCTCCAACCAGCCTCGCTTTATGCGACGCA
ACAGTGACGCCATTTCATCTCGCACCGGCTTCTGCAAGCA
TTGTGAAAAGATCCTGAAATTTGAATTTACATTATTAAAA
TGGTGAAAATCTTTGTTGGGAACCTCTCGCCGAACACTAC
GGCTGAGGAGATCCGTTCCCTCTTCTCTCAGTATGGCAAG
ATCTCAGAGTGTGACATTGTGAAGAACTTTGGCTTTGTGC
ACATGGATAGCAAATCGGAGGCAGATGAAGCCATTCAAAA
TCTTCATCATTACATGCTGAATGGTATGGCCATGAATGTG
GAGATGAGCAAAGGGAAACCCAAGACCTCTACAAAACTCC
ATGTGGGAAACATCAGCAGTAGCTGCACCAACCAAGAACT
CAGGGCCAAGTTTGAGGAGTACGGACCTGTGGTTGAGTGC
GATATTGTGAAGGACTATGCTTTTGTTCACATGGAGCGAG
TGGAAGATGCTATGGAAGCCATCAGTGGCTTGGACAACAC
AGCCTTTCAAGGCAAACTGATGAGCGTGAAGCTTTCGACT
AGCCGCCTGCGTACCGCGCCGGGAATGGGAGAGAGAACGG
GTTGTTATCGGTGCGGACAGGAAGGCCACTGGTCCAAAGA
ATGTCCATTGGACCAGAACGGCTCCTACAGAGAGGGCCCG
AGCTCGGAAGGATTTGGGCCTGTCAGGTTCGATTCGGGCG
GCGATCGTGGCCGGGGTTTTCATCGCGGCTTCAGTGGCGA
GCCAGCCTACGCTGGCAGCTTTGCACCTTCACATGGCTTC
ACCCGTGGAGCAGGGTATGCTGTCCCTGGGTATGGAAGGG
GTGCGGGTTTTGAGAGTGCAATGGGTTATGGTATGCCAGC
GGGCTACGGTGTTGGCGCGGATAATAGCATGGCTCCAGTG
TACGGAAGCGAGGCTGCGTATGGGACTAGTGGCATGGCCT
ACCCCGGTGCGTTGCCTGCGTACCCGATACGACGACCACC
TTATGAGGAAAGAGATCCGTATGGTGTAGTGGACTTCTAC
GAGAAATATCGGGCACGTCCGTACGGAGGCAGTTATTTCG
AAGATAGACGCGCGGTTCAACCTCCTGTCCCTCCTCCCCC
CACTTCTACGCCAGTTGTGAGAGAGCGCCTGCCCTCTAAC
CTTGTCGACCCATATGAGCGCCATCCCCTTCCCCCTCCTC
CGGCTCCCACCTCTTCATACTATGTCCGTGAACGGAGCCC
GGTCCGACGAGCTCCACACGAGGCGGAGGGATACGCGTAT
GAGCGGTCGCGCCTCTCTCCCATCTCTGTGCTTCCCAGGA
CTGCTGCGTATGACGTGCCGCGGGATCCATACGCTGAACG
GGCGCGCTATGCTTACTAGCCTAATTCCTGTGCGCACTCA
GGTGGCTCTTGGTTGCACACGGAACATTTTAGAAGTTGTG
ATGCTTCCTGTCTCGACTGGGTCACAGGCAGTAGAGATGG
CCCACATCTCGGCACTAATCTACTTTTATTGTCATAAACT
TGATGTAGTCCTGTGTTTTTGTTTTATTTTTATTTTTTTT
TTTATTCTTGGTACAAAAAACTGTAAATATTTTCTTCATT
AATTAAAAAAAAAAAGTTTAAAAAAA

rbm4.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rbm4.1-002 (1) 580
mRNA rbm4.1-201 1626
rbm4.1-203 (1) 753
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbm4.1-201 Contained in:
OTHER rbm4.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036743 (1)
  • Ensembl_Trans:ENSDART00000052862 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC155175 (1) 1679bp
    GenBank:BC046057 (1) 1645bp
    GenBank:BC071513 (1) 1551bp
    GenBank:AM422105 (1) 472bp
    CITATIONS (2)