header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1712
Transcript Name: jun-201
Previous Name: jun-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010376|OTTDARG00000009040|ZDB-GENE-030131-7859 jun|OTTDARP00000008939 jun-001 LG_ CR392368.7 Danio rerio protein_coding KNOWN, 1950 bp
GCAGATAAGGTTTGCCTCCACGCTGGAGAAGCTCAGAGTA
TACAGACCTCGCCACAGTGAAACACCTCACTCAAACCAAC
ATAAATAAGCCTTCGGCTAAGCACTGTTTATCTGCTGGTG
TCTGAGAAGCGCGACAGCGGCGGAGGAAGAACTTTCTATC
CGCGGAAGGCAGGAGGAGACGAGCCCGTGACACTGGCGAT
AACTTTACGCAGTAAGTTTCTCGCGGGACGGGGAGTTGAG
GAACTTTTCCAATCCTCTCGCTTTTGTTCCAAACACCGCA
GCGCTCGTTACTGAACGCGGACAGTGCTTAACAGCGCCTA
AAAGACTGCTTCTGAACTAAAAGTTTCGCTTTGCCTTCTA
TGTCTACCAAGATGGAAACTACTTTCTACGATGACTCTCT
AAACAGCGCTTTCTCTCAGCATGACAGCGCCACTTTTGGA
TACAACCACAAGGCTCTGAAACACAACATGACGCTCAATC
TGTCCGACCCCGCGGGGAACCTAAAGCCCCACCTGAGGGC
CAAAGCCAGCGATATCCTCACTTCTCCCGACGTGGGACTT
CTCAAACTGGCATCACCGGAGCTGGAGAGGCTCATCATCC
AGTCTAGCAACGGCATGATCACCACGACGCCAACTCCGAC
CCAGTTTCTGTGTCCCAAGAACGTGACGGATGAGCAGGAG
GGGTTCGCGGAGGGCTTTGTGAGGGCACTGGCTGAGCTGC
ACCACCAGCACATGCCCAACGTCACCTCGGCTCCCCAAAC
TACTATCAACAGCAGCATGGCACCGGTCTCGTCCATAGCG
GGCGGTGCGGTCTACAGCTCAGCCATGCGCGCTGATCCGC
CGGTTTACGCGGATCTGAACACGTTCAACCCTGCTATCAG
CAGCAGCTCGGCCAATCCAGCCGCGATGAGCTTCCCGAGC
GCACCACCGCAGCTGCCCGTCCAGCACCCGCGCCTCCAGG
CCCTGAAAGAGGAGCCCCAAACGGTGCCCGAGATGCCCGG
CGAGACCCCACCGCTCTCTCCTATCGACATGGAGAGCCAG
GAGCGGATTAAAGCCGAGAGGAAGCGCATGAGAAACAGAA
TCGCCGCGTCCAAATGCCGGAAGAGGAAACTGGAGAGGAT
CTCCCGGCTGGAGGACAAAGTCAAGACCCTGAAGTCGCAA
AACTCGGAGCTCGCGTCCACCGCCAACATGCTGCGCGAGC
AAGTGGCACAGCTCAAGCAGAAAGTCATGAACCACGTCAA
CAGCGGCTGCCAGCTCATGTTGACACAACAGCTGCAAACC
TTCTGAGGAGAGCCGAAGGACATTTTGAGTTCAGCCACAT
AAACAAACTTCAGGGGCTTGATGTCTGCGATCTGGCGCGA
CAGAGCCCGCGGGGACCGGGACCGTCCGGCCGGCCGCGTG
CCGTTAAAGGATGATCCGACTGGACTTTTGAGGAGCGCAA
AACTTCACTCGGTCCGACAGAGACGCAGAGCGCATGAGAC
TCACTCTGTTACATGTTTTACTTTCTGACGAAATCCTTGT
TCACATCGACCAGGTTGTGCATGGACCTATACGCTTCAAA
GGAGCACTCAGTATTATAGGAGTAAAACAGAGACGCGACT
GCCGTACAGTAGGGATACTGGCTCACCAAGCAGGACGTTG
TGTCTGCTAAACTTTTGATAAAAAAGCTGCCTGACTTCTG
AGCTACATATTGTACTTTTTTTGTTGTTCTTAAATTGAAC
GGAAATCGACTTTTTTCCTTTTGAGTTAGTCCAACTTAAG
CAGTTTCTTTTTCTAAAAAAAAAGTTCATTAATGAGGTTT
CACTCATTGTTATTTGTAAATATGATCAACCAGGAGTACT
TAAGTTTACCATTTGTAAGTAAAGTACAATAATTTTTTAT
GTTTGTTTTCTGAGCACCTCAGAAACTAATCAATATTTAT
GAACTGTAATAAAGTATGTCAAATGAAAAA

jun TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA jun-002 (1) 341
jun-003 (1) 581
mRNA jun-201 1950
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jun-201 Contained in:

OTHER jun-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000010376 (1)
  • Ensembl_Trans:ENSDART00000063912 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056597 (1) 1940bp
    GenBank:BC065976 (1) 1923bp
    CITATIONS (2)