ZFIN ID: ZDB-TSCRIPT-090929-17119
Transcript Name: ddit3-201
Previous Names: ddit3-001, zgc:162630-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036658 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036658|OTTDARG00000027306|ZDB-GENE-070410-90 ddit3|OTTDARP00000029406 CH211-125M22.3-001 LG_ BX950854.12 Danio rerio protein_coding KNOWN, 1388 bp
ACACTCGGTGACTTCAGCTGAACAATGGTTAACATGAGCG
ATCAGCCATCTCTACAAAAACACACACAGACCCTGAATCA
GAAGCAGCCGAGGAAAAGAAACAATAAAAAGAAAAGGAGT
TATTGGGACAAAATATCGCCAACAACTCACATTCAAACTT
GATTGACAAGAGTCTCTTTATAAGGTCTGGTGTGCTAGGA
GTGGGAGCGTGTCGTATTGTGTCTGTGGATAGCGACTGAT
TGGTGCGATGACTGCGGAGTGGCTGTACCCCCCTGGCGTG
GGGCCGCTGTGTGGTGCAGAGTTGGAGGCGTGGTATGAAG
ACCTACAGGATATACTGGGCTCCGACACGGGCGGGGCCAA
ACTTACAAGAGCCCCGCCTTCTTCAGAGAAGGAGCCTGAG
TTTTTGGATGTTTTGGAGAGCTGTTCGCTCACCTGGTTGA
CCGAAGGGCAGGTATGGGGCGACGGGGTGCAACGGGTCAC
CGAAGATCCGCCCGTTCACCAATCGCCACCAAGGCAAGAA
GAACGAACCACGGAGAACACCTCATCCGGAGATCTCCTTC
CGCCGGAGTTTTTCGAACTCCTCAGCGAAGGTGGTGTTGG
TGACACCATGGTAAACGGAGGCGCTGGGTATCACCTGCAT
GCACCTCCATCTCCAGCCGCCAGCGAAGAGGAGGAGCTCC
CGACGGTTCCCGACACATCATCCTGCTCCTCAGCGTCCCG
TTCGCCTTCTCTAAACTGCTCCCCGCCGGCATCTCCACCC
GTCTCCTCCTCACGCAAAAGAAAACGAGGCGGCGCACTTT
GCTCTGCATCCCCTGGGAAAAAGAGCCGCAGAGAGCGCGA
ACAGGAGAATGAAAGGAAAGTGCAGGAGCTGACGGATCAA
AACGAGCGGCTGAAAGCCGAGATCGAGCGACTGGGCGAGG
AGGTGCAGAGGACGCGGCGGGCGCTTATCGAAAGACTGGT
CAACACCCGCAGGTGAATGAGCAACAGGAGGACATGTAGA
GAAGAAGGGGACGCCAACAATCGGAGGAAATTCTTCTTGT
GGAGAGCGTGAAATGCACATTTAGAGGGAGATAAAAGACA
CGTGGGATTGAGGGGGGAGAAAGGGAGGTTTAGTGAATGT
CTCCCACCGAGAGAAAGAGAAAGTCAGATTAAGCCGTAGA
AAAGAAAGAATGTGGAGCTCAACGGAAAACGCAGGCCGGT
CAAAACTCAGCCCACCACGCATGCAGACTTCAAATTAAAA
TATGAAAATAATAAGAAGAGATTTAGTTCATGCTAAAATT
AGTGTAGCTCAAAACTAATACTACTGTTTAAATGTTATAG
CGAAATTCCAAATAAGGAATGTTTGCAACATCAAATGGCA
ATTAAACACAAACTTGATTTGTAACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddit3-201 Contained in:
OTHER ddit3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036658 (1)
  • Ensembl_Trans:ENSDART00000083628 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC134052 (1) 1415bp
    CITATIONS (2)