header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16746
Transcript Name: ctnna2-201
Previous Name: ctnna2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036242 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036242|OTTDARG00000027079|ZDB-GENE-060815-3 ctnna2|OTTDARP00000029086 ctnna2-002 LG_none BX927206.17,CT997814.5,CT998561.11,FP340494.5,AL929516.15,CR391918.7,CU076051.6,CR925858.7,AL626804.10 Danio rerio protein_coding KNOWN, 3382 bp
GGCGGATTTTTGGGGCTTGTTTCAACTTACTGGCTTAGGT
TTGAAAGCCGTCCGTTTGGAAATAAACCACAGAACCGTAA
TTCCTCGGAAGTGTTTTGTTCCTGCACCGGGGCTGTCATC
ACTGAAGAGTAAACATGACGAGCGCTACGTCCCCAATCTT
GCTAAAATGGGACCCCAAGAGTCTGGAGATTCGCACACTG
ACGGTGGAGAGGTTGTTGGAGCCGCTGGTCACACAGGTGA
CCACCCTGGTCAACACCAGCAACAAAGGCCCGTCCAGTAA
GAAAAAGGGTCGCTCTAAGAAGGCTCATGTTTTGGCTGTG
TCCGTGGAACAGGCCACCCAGAACTTTCTGGAAAAGGGTG
AGCAGATTGCTAAGGACAGCCAGGACCTGAAAGAGGAGCT
CATCGCAGCTGTAGAGGACGTCCGCAAGCAAGGGGATACA
ATGCGCGTGGCGTCCTCAGAGTTTGCAGATGACCCCTGCT
CCTCTGTGAAACGGGGCACTATGGTCCGTGCTGCTCGAGC
CCTGCTCTCTGCCGTCACCCGCCTGCTCATCCTGGCTGAT
ATGGCTGATGTCATGAGGCTCCTGGCTCACCTTAAGATTG
AGCTGAAGGACCCTCAGTGCAGAGATGAGATGGCAGCGGC
TCGAGGAGCTTTAAAGAAGAACGCCACCATGCTCTACACT
GCCTCCCAGGCCTTTCTGCGCCACCCTGATGTGGCTGCTA
CACGTGCCAACAGGGACTACGTCTTCAAACAGGTTCAGGA
GGCCATCGGGGGCATCTCCAGCTCTGCCCAGGCCACCTCA
CCCACTGATGAGAAGCATGGGCACGCTGGCATCGGAGAGT
TGGCCGCCGCGCTCAATGAGTTTGATAATAAGATCATTCT
GGACCCGCTCACGTTCAGCGAGGCTCGCTTCAGGCCGTCA
TTGGAGGAGCGTCTGGAGAGCATCATCAGTGGCGCTGCCC
TCATGGCCGACTCGTCCTGCACACGGGATGATCGCCGCGA
ACGCATCGTAGCTGAGTGCAACGCCGTGCGTCAGGCCCTG
CAAGACCTGCTGAGCGAGTACATGAACAATACTGGAAGAA
AAGAAAAAGGAGACCCGCTCAATTCGGCTATTGACAAGAT
GACCAAGAAGACCCGTGATCTTCGTAGACAGCTAAGGAAG
GCCGTTATGGACCACATATCCGACTCCTTCCTGGAGACCA
ACGTTCCTCTGCTGGTGCTGATAGAGGCGGCCAAGAGCGG
AAACGAGAAAGAGGTTAAGGAGTATGCGCAGGTCTTCCGT
GAACACGCCAACAAGCTGGTGGAGGTGGCCAACCTCGCCT
GTTCCATCTCCAACAATGAGGAGGGGGTGAAGTTAGTGCG
CATGGCTGCTACACAGATCGATAGCCTGTGTCCTCAGGTA
ATCAATGCAGCCCTGACCTTGGCAGCTCGTCCTCAAAGCA
AGGTTGCTCAGGATAACATGGATGTCTTTAAAGACCAGTG
GGAGAAGCAAGTGCGCATCCTGACTGAGGCAGTCGATGAC
ATCACTTCCGTTGATGACTTCCTGTCTGTCTCAGAAAACC
ACATTCTGGAGGATGTGAACAAGTGTGTGATCGCCCTGCA
GGAGGGGGACGTGGACACTCTGGACAGGACAGCAGGGGCG
ATCCGGGGCCGAGCTGCTCGTGTGGTACACATTATTAATG
CTGAGATGGAGAACTACGAGCCTGGCGTTTACACAGAGCG
CGTTCTGGAGTCCATCAAGCTGCTCTCTGAAACTGTGATG
CCACGCTTTGCTGAGCAGGTTGAGGTGGCCATAGAGGCTC
TGAGCACCAGCCCCCCGCAGCCATTTGAGGAAAACGAGTT
CATCGATGCCTCTCGCCTCGTCTACGATGGAGTGCGTGAC
ATCAGGAAAGCAGTCCTCATGATAAGAACCCCAGAAGAAC
TGGAGGATGACTCTGACTTTGAGCAAGAAGATTATGACGC
TCGAAGCCGTACCAGCATCCAGACAGAAGATGACCAACTT
ATTGCTGGACAGAGCGCAAGGGCCATCATGGCTCAGCTGC
CTCAGGAAGAAAAGGCCAAGATTGCTGAACAGGTCGAGAG
CTTCAGGCAGGAAAAGAGCAAGCTGGACGCTGAAGTCGCT
AAGTGGGATGACAATGGAAATGACATCATCGTGTTGGCTA
AGCAGATGTGTATGATCATGATGGAGATGACTGACTTCAC
CAGGGGTAAAGGCCCTCTGAAGAATTCCTCTGATGTGATC
AACGCCGCCAAGAAAATCGCAGAGGCTGGATCCAGAATGG
ACAAGCTTGCCCGTGCCGTGGCTGACCAGTGCCCAGATTC
AGCCTGTAAGCAGGACTTATTGGCGTACCTCCAGAGAATC
GCCCTCTACTGCCACCAGCTCAACATCTGCAGCAAGGTCA
AGGCTGAGGTTCAGAATCTGGGAGGAGAGCTCATTGTTTC
CGGGCTGGACAGCGCTACATCCCTCATCCAGGCAGCCAAG
AACTTGATGAATGCTGTGGTCCTCACAGTCAAGGCCTCCT
ATGTGGCTTCCACCAAGTATCAGAAGGTGTACGGCACAGC
GGCGGTCAACTCCCCAGTGGTGTCCTGGCGCATGAAGGCC
CCGGAGAAGAAACCCCTGGTGAAGAGAGAGAAACCGGAAG
AATGCCAGACCCGAGTCAGGCGAGGTTCGCAGAAGAAACA
TATCTCCCCCGTCCAAGCCCTCAGTGAATTCAAGGCCATG
GACTCCTTTTAACTCCGCCCCCCCTCCAGAAACCCAAAAC
TCCTCCTCCTCCTTCTGTCTTGATTTCTACTCCTCTCCCT
GTTACGGCTTATTTTCCCGGAGCTGTATCTTTGTTCCATG
CAGCGACGTCGACGTGTGTGTATGTGCCCAGTAAATGTTT
GTGACTTGGGAGGATTTGGCCACCATTCCTCTTCGAACCA
AATTCCGCTGTAAATGAGAAACAAACAAACTCGTGGAGAC
GTTTACAGTGCGGGCTGCGGTACAATTGATGTGGTGTTCA
TTCTTGCTGAGCGGCCATATATACACAGAGATATTAAAGA
ATATAATCTATGGTATAGTAGTGTCAGCCCTAACCGAGAC
ACAGGTGCTGCTTTCCATCCTATTTTTTATTATTATTATT
TAAAATGAATATGACCCATAGTAATAGGAATAACTTATGT
TCAAGCAATTCTCTTCCCAGTTATCCATACGGTAATGATG
CACTAGTTTTTGCATTAAAAAAAAATCCATTTCTTTAATT
ATATTACTGTATCACTAACCATGGCAGCCAGGTCGGCTAT
AGTATTACATTTAGAAAAGGACTAGTTGTGTGGTTTGCTC
AGAGACTAGTAGAATCCTGCATACTTTATAGTCCTGATTC
TCTAATAAACCTTGCAACTGTG

ctnna2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ctnna2-201 3382
ctnna2-204 (1)    Ensembl 1560
ctnna2-205 (1)    Ensembl 899
ncRNA ctnna2-004 (1) 554
ctnna2-005 (1) 822
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctnna2-201 Contained in:
[Fosmid] CH1073-15I3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036242 (1),  Ensembl_Trans:ENSDART00000101306 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC131855 (1) 3426 bp
CITATIONS (2)