header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16741
Transcript Name: ednraa-003
Previous Name: ednra-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036237 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036237|OTTDARG00000027076|ZDB-GENE-010906-2 ednraa|no_translation ednra-003 LG_ CR762429.11 Danio rerio protein_coding KNOWN, 391 bp
ACACACATACAGCAACTCTCCACAGGAAAAGCTGGAGACA
GAATGCGCAGCCCCTTCACAGCAGCTTTGGTGCGTCGTGG
CGTCCAAATGGGATTCTGCTAGACTTTGATAGTTGGTTAA
TTACTCATATGATACCACACAGATGTCTGGGGGGCTCTAG
CCGAATATTCGTCTCTCACTAACTCACTGACTGACTGACT
GACGGGATCCTGGGGAAGGCAGACATTTAAGGAGCGCTGC
TGGTCACAAAGTGGCCATTTGATGACAGCTCCTTTGGACT
CTTCCTGTGCAAACTTGTGCCATTCCTCCAGAAAGCGTCT
GTTGGGATTACAGTGCTCAATCTATGTGCTTTGAGTGTGG
ACAGGTACAGGGCTGTAGCCTCCTGGAGCAG

ednraa TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ednraa-003 391
mRNA ednraa-201 (1) 2665
ednraa-203 (1) 200
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ednraa-003 Contained in:

OTHER ednraa-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036237 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB851091 (1) 395bp
    CITATIONS (1)