ZFIN ID: ZDB-TSCRIPT-090929-16628
Transcript Name: nr2e1-201
Previous Name: nr2e1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036088 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036088|OTTDARG00000026992|ZDB-GENE-040801-127 nr2e1|OTTDARP00000028956 nr2e1-001 LG_ CU138515.8 Danio rerio protein_coding KNOWN, 2710 bp
ATCTGACGGTACACATCACAAAGTCACTCACCAAGGCTTG
GGCTGCGACGCATTTCCCAGCTCACGTTGTACATTTGAAG
CAGGTGTTGAGCGGTACAGTTGTTGGCTTGGTTTCACAGT
TAGTTGCACCAACTTTTACGTGGGGCAGAGAGATCAGAGA
CCAGCTTTGGCATATCATCTGTGAAGCTGCATCCATCATC
CATCAACAGTGAGACGTAATTCGGATTTTATTTGCTGAAA
AACAAGAGGAACATTTTGGACACATTCAGAAACTGCAAGA
GAAATCAAAGGACCAGTTGTGCACCGCAAATCGGATGTTA
AATGTATGTTTCTTTTTTCAATCTAAGTCAAAAGTGCTAA
GACTGCCCTGGGCCTGAAAAGTTGAACTTTTGAAACGCAA
TTTCTCGGAGCCGTGGTCTTCAATATGAGCAAGCCTGCTG
GTTCAACAAGTGGTTGTCTGGATATTTTAAATGTCAAATC
CAGTCGGATTCTGGATATCCCGTGTAAAGTATGTGGAGAC
CGAAGTTCTGGAAAGCACTACGGTGTTTATGCGTGTGACG
GATGCTCGGGATTTTTCAAGAGAAGCATAAGAAGAAACAG
AACGTATGTCTGCAAATCTGGCACACAGGGCGGCTGTCCA
GTTGACAAGACACACAGAAATCAGTGTCGCGCCTGTCGCT
TGAAAAAATGTCTTGAAGTGAATATGAATAAAGATGCTGT
GCAGCACGAGAGGGGACCGAGGACATCAACTATTCGAAAG
CAGGTGGCACTGTATTTCCGAGGGCATAAAGAGGTGAACG
GTTCGTCGACCCATTTCCCATCCACGTCTATCCCGGGGCC
GCCGTTTTTCACTACAGTCACGCAGCTGGAGCCTCACAAT
CTGGAGTTAAACACGGTCACAAGCACACCGGAAAGGCAGG
CAATTGTGGGACTTGCTCAGCCCACACCGAAGTATCCTCA
TGAAGTTAGCGGCACCCCCATGTACCTGTATGAAGTGGCG
ACCGAGTCTGTGTGCGAATCAGCCGCGCGTCTGCTTTTCA
TGAGCATTAAATGGGCCAAGAGCGTTCCTGCCTTCTCCAC
ACTCCCTCTACCTGACCAGTTGATCCTTTTAGAAGATGCC
TGGAGAGAACTGTTTGTGCTGGGTATTGCACAGTGGGCCA
TTCCAGTAGACTCCAGTACCCTCCTAGCTGTTTCAGGAAT
GAACACGGAGAACACAGATTCCCAGAGGCTCAACAAAATA
ATTTCGGAGATCCAGGCGCTGCAGGAGGTCGTGACGCGCT
TCAGGCAGCTCAGACTGGACGCGACGGAGTTTGCTTGTCT
CAAGTGCATAGTCACATTCAAAGCAGTCCCAACACACAGT
GGTTCGGAATTGAGGAGCTTTCGCAACGCGAGTGCCATTG
CAGCACTTCAAGACGAAGCCCAGCTGACTTTAAACAGCTA
CATTCACACCAGGTACCCCACTCAGCCATGTCGTTTTGGG
AAACTGCTGTTGCTCTTGCCTGCTCTACGTTCAGTCGGAC
CATCCACCATTGAAGAGGTGTTCTTCAAAAAGACCATCGG
AAACGTGCCCATCACACGACTGCTCTCCGACATGTACAAA
TCCAGCGATATATGAGCTACTGAGAGACAGAAAAAACAAA
ATGTATCGTTGACCTTGGCTTTCGCATGGACGCTGGGACA
ATGTGGACAATACCAGATGTCCTATGTGACACATCACGCA
CTTCTCTGGAGAATAAAGCTCTACCAATGTCAAGATGTTT
TACGCAGGGAAATTATAAAAACAGACAGACTCACTTGCTG
CAAGTTGAGCTCACTGCTTAGAAAGAAAAAAACGAACTTT
TAACCAGTAATTTTCTAATTGATTTACTTTATTTAAGTTC
GTTTATGAAAGTAACTTAACAAGTTTAATCTGTTCATGTT
CTTTCAAGATTTAAATACAAAAGTATCTTAGTTTGTAGTC
ATATATTTGAATGGGGTGTCCGTGAGGTTATGTACAATCA
TTCATTTCAAAATAGGACGTGTATGTCCACTTGACCAAGT
ACCTTTTTTGACCAATGCTGTTTTGAATTCAGCGCCACTA
ATATTCATTTGTCAACAAGAAACCAAAAATGACAAAGAGA
CCATGAGGTATGTTGCAGGGAAGTAGGTCGCTGTCCCTTT
GACATAGTGCTGAAAACCAAAGGCCCATGAGTCAGAACTG
AAGAGCAAGTTCATTCCTGTTCTGCCTTCTGTAGTAGAAG
CTCCAACTTTAATCAAAAACACTTGAACCAACTAATCGGG
TTTACTTGAAATGTTTGTTGAACAGTTGGAGTTAAACTCT
GCATGAAGGCAGCTGGATTGAGCATTCCTGACTTAATGCA
TCACATAATTACCTACTGAGGTGACTGAAAGGCCACAGCA
CCCACACCTTGTGACCTTAATGTAAGATTAGGATTCACTG
GCAGGGCATCTAAAATCCTTTGGAAATATTTTTGTTGAAT
TTTCTGTGCACCCACTCTGCCATTTTAATTTTATTGATGT
TTAAAAAGCTTGATAAGTGGCCCATGTCAGAGGTCACCAT
TAAGTACCTTTGTTTAAATAGCTACTAACCCTGGGAAAGA
GACACAATCAGCACTTGGATTTTTTTGTAGTCTGTAAATA
CATTTCCTGTTGTACAGTGATAATTTTTGTGAAAGTTGTT
CTAAGATATTAGAATAAATATTGAATATTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nr2e1-201 Contained in:
OTHER nr2e1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036088 (1)
  • Ensembl_Trans:ENSDART00000026635 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC077146 (1) 2730bp
    GenBank:EF010862 (1) 1787bp
    GenBank:CN835562 (1) 866bp
    GenBank:AI721647 (1) 561bp
    GenBank:AI667356 (1) 527bp
    CITATIONS (2)