Transcript

zgc:174904-201

ID
ZDB-TSCRIPT-090929-16191
Name
zgc:174904-201
Previous Names
  • zgc:174904-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035578 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035578|OTTDARG00000026712|ZDB-GENE-080204-76 zgc:174904|OTTDARP00000028579 CH211-264F5.4-001 LG_ CU207217.7 Danio rerio protein_coding KNOWN, 1903 bp
GCGGTGGTCAGAGTGCGCTTCATGTTTGTGTTAGTGTGCA
TGTGCAAACGTGAGCAATGTCTGCATACAGAGAAGAAATC
CACAACAATCTCATTGACGGACCCGATGATGACTACAGCG
GTGCAGAGCTGCGATATTCAGTGTTTCAGAATCCAGGAAA
ACATAGAAAGAGGTTTTGCCAAGAACCCTTCAAGGTGGCA
ACAGCGTGTCTGACTGCCTTCTGCCTGATTTTGCTCTTGG
TCCTGGTGGTCACAGGTCTTCACGCTGGCAAGACCAGTTC
ATCAGGTCAGGATTCCTCCTCCAGTGCTGCTGCAGCACAC
CAGCAGACAGGCTCCATTAATGTAACAGCTCTGACCACTG
AGCTGCAGACGGCCAAGAGAGAGAAGAGTGAACTGGAGAA
AGACAAGAGTGAACTGGAGAAAAAGAAGAGGGAACTAGAG
AAAGAGAAAAGTGAACTGGAGAAAAAGAAGAGTGAACTGG
AGAAAAGGAAGAGTGAACTGGAGAAAGAGAAGAGTGAACT
ACAGAAAGAGCTGTTGCAGCTCAAGGATAAAGTCACTAAG
TGTGAGGTGACTCCTGCACCCCGAACCACTCCAGCGCCGA
CCACAAGTCCTTGTCCTCAAAACTGGAAGCATTTTAATGG
CAGCTGCTACTTCATCTCAGTGACCACCAGGAGCTGGACA
GACAGTCAGACGTACTGCAAGAGATACGGAGGACACCTGG
CCATCATCCTCACAGCTGAGGAACAAACATTCATATGGGA
CCTACTGCCCCGCGGATACTGGAACGCTTTCTGGTTTGGC
ATTAGTGATGAAAAAGTAGAAGACGACTGGCACTGGGTGG
ACGGAACCAAACTGGTGGGAGGTTTCTGGGAAGACGGCGA
GCCCAATAACCATATTGATGAAGACTGTGGCTACATGATA
AAGACTGATGTTTTGACCCGTGTGGCTATAAAGAGCTGGT
ATGATGCACCCTGCCACATGTCTTTGCCATGGATCTGTGA
GAAACCGGCATCCTCTTGATCATCATCTTCATCACCTTCA
CTGATCATTAATAATACATTACACATTGTGTTTAGATTGT
CTCAGGGTTTAAAATGTCTAACTGCAGTCAAAATGCATTT
AACTGTATTTTATAAATCTAACAGGGTATATTTGTTCCTA
ATTTAGTTATTTTTTACACTAGGATGAGCGAGTTATTTCA
TTAACTGCTTGAATCTTATGTTAAACCATAAACTAGCTTG
AGTCTGATTTGTCACAACCATGAGGTAGCCTATAGGCTAT
ATGTTTTTAGCATTTTAGCACAACGTTCGTTAGGCTATGT
TTAGCACATGTTTCTGTATGCTATTGCTAAACTACTTGTT
GTGTTTTGTTTTGTCTTTGTAAACTGTACATGTTGTCTCT
GTAGTTTAAAGGGTACCGATTTTAAAACAGAAGTCTTATT
TTTGTGAGGTACAAAAGTATTCAGCAAGAGTTTAAGATGC
AAAGAAACATTAGCGAGTAATGTGAGGAGTAAACAATGAT
TTTAAAAAGAAATAAATGTTATATAAAACAAATAAAATTG
AAAATTATTGTAGCGGAAACATTGCTGTCCAATATTTATA
AACAGTATATGTAATGTATATAGGGGTCACCAACAAGGTG
CCTGCGGGGCATCAGGTCACCTGCGAGGATCACAAGAGTG
CCGGCTATGTTAAAAATGCTGTAGATTTGGTAATTGTTTG
ATAACTTCAGTAAAATCTGAAAGCTCATTTATGTTACACA
GTTGATAATCTGCACAAATATGGTACACCGTAGTGCATGA
TTTCTTAAAAAATGTAAGTGGCTACGGAAAATATTGTAAA
AATTATCATTTGAAAATGTAAAATACTTGCAGAGGTTTAT
AGAAATAAAGTGTTGCATATATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations