ZFIN ID: ZDB-TSCRIPT-090929-15596
Transcript Name: plat-001
Previous Name: si:ch211-220d9.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034899 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034899|OTTDARG00000026320|ZDB-GENE-081104-181 plat|OTTDARP00000028088 CH211-220D9.5-001 LG_none CT583679.13,AL954172.9 Danio rerio protein_coding NOVEL, 1995 bp
ACACACGGAGGAGAAACGCAGAGTCGCTTCACTTTGGATT
AAGACGCATTTTGTTTTGAGAGGAAGAGAAGTACCGCGCA
CTTGTTTCTGGAGGAGAATACAGAGATCTGCAGGAGAGCA
TGAATTTATTACTGAACCTGCTGCTGCTTCTGTCTGCTCT
GAGCTGTGCTGCAGATCCCACAGAGCTGCATGACAGACAA
AAAAGAGGAACTCGCAATTATAGAGAAGCGTGTGTAGACT
CTAATTCGGCCGCGGTCAGAGACATTGGTGTGACGTGGCT
GCGATGGAAAGGACTGAAAGTCGAGTTCTGCCGCTGTGCG
TTAAGAGGAAGAGCTCGCTGTCATGAGGTCCCTGTGACTA
AATGCTTCGTGTCTAAGTGTTATAATGGAGGGACGTGTAA
AGAAGCGCTTTACTCCAGTGACTTCATCTGCCAGTGTCCG
CCCGGCTTTACAGGCACACAGTGTGAAATCAATACTCTTG
AGAGATGCTCCAGAGGTCAGGGGTTGGGATATCGAGGCTC
GTGGAGCGTCAGTTCGTCAGGAATGGAGTGTATTAACTGG
AACTCCAGCTCTCTGCGAGGGAAGAAGTTCACTGCGAGGA
GACCAGAGGCGAGCACACTGGGTCTGGGGAACCACAACTA
CTGCAGGAATCCAGACGGAGACTCTAAACCTTGGTGTTAT
GTATATAAAAAGGCTCAGATCTCATGGGAGTTTTGCTCTT
TACCGACATGTGTAATAGACCCGTATCTGGAGTGTGCTCA
GAGATCAGGTCAGACCTACAGAGGGACGAAAGCCATCACA
CGCAGCGGTCTGAAGTGTCTGCCGTGGGATTCACCCGCTG
TTTCTCATAAAATCTACAACGCGTGGAGATCTGATGCCAG
AGAGATGGGCATCGGCAGTCATAACTTCTGCAGGAACCCA
GACGGAGACCTCGGCCCCTGGTGTCACGTCTATAAAGGCT
CTCAGCTGACCTGGGAACTGTGTGATGTCCCCCAGTGCCC
GAGGAAACTTCCATCAATCACCACACTTGGACCACGAGCC
CCTGCAACCACTAACAATCAAGGTGTGTGTGGTCAGCGTG
AGTCTCCGTCTAACCTGCTGCCGATGTTCAGGATTCGTGG
TGGTCAGGCCAGTGACATCAGAGAGCAGCCGTGGCAGGCG
GCCATCACCGTTTACCTGCCGCGCTCAAAAACACACAACT
TCCTGTGCGGTGGCGTCCTCATTGACTCCTGCTGGATCCT
CTCAGCCGCTCACTGCTTCCAGCAGAGATACGAGGAGAGT
CGTTTGCGGGTGGTTTTGGGTCGAACCTTCAGGCTCCAGA
ACTCCAGCAGTGAGCAGATCTTTGACGTGGAGAAATACTG
GATTCATGAGCAGTATGACGACGAGACCTACGACAACGAT
ATCGCTCTGCTCAAGCTGAAGAGTGAGTCTGGGATCTGCG
CGGTTCACTCTCCTGAAGTTCTGCCCGCATGTTTACCAGA
ACCTAACCTGGTTTTACCAGACTGGACAGAGTGTGAGATC
TCTGGTTATGGAAAAGAGGAAGAGTTTTCTCCGTTTTACT
CAGAGAGGATCAAGCGTGGTCTGGTGCGTCTGTGGCCGCA
GGATCAGTGTGTCCCTGAAAAACTGTCTGGTCGACTGGTC
ACCTCAAACATGCTGTGCGCTGGAGACACCCGAGGGCTGG
ACGATGCCTGCAAGGGGGATTCTGGTGGTCCTCTGGTGTG
TCAGAAGAACGGCAGGATGACTCTGATGGGTTTGATCAGC
TGGGGCGACGGCTGTGGGAAAAAGGACACGCCTGGAGTTT
ACACACGCGTCACCAAATACACAAATTGGATCTCCAGCAA
GATGAGCGCAAACTAAGACAAGCGCAGACAGAAAGTCATG
TGCTGGAGGAAAAAACATCACATTCACCAACCTGCTGGAG
TGTTTGTGACTGAAGGAGGACAACATCTGAGAGTTTGTGA
GTTTTTGCACACCGGACTGCACATCTGAATCCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
plat-001 Contained in:
OTHER plat-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034899 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN326696 (1) 906bp
    GenBank:EB778815 (1) 550bp
    GenBank:AL921999 (1) 518bp
    GenBank:BI473459 (1) 477bp
    GenBank:EB783276 (1) 442bp
    CITATIONS (1)