Transcript

snap29-201

ID
ZDB-TSCRIPT-090929-15584
Name
snap29-201
Previous Names
  • snap29-003
  • si:dkey-178e17.4-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000034887 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034887|OTTDARG00000026311|ZDB-GENE-041111-226 snap29|OTTDARP00000028078 DKEY-178E17.4-003 LG_ CR788303.14 Danio rerio protein_coding NOVEL, 773 bp
GAACTGATCCGTCAGGGAGAGGCTCTGAAGAGGACAGAGA
GAATGATCGACAACATGGAGCAGGACATGAGGACGAGCCA
GAGGCACATAAACACCATTAAGAGTGTGTGGGGGGGGATG
GTCAACTATTTCAAAGGCAAACCTGAACCACCCAAACCAG
CACAGAAGGACCAGCCGGTGTGTTACGAGGCCAGCAGCAG
GCTACAGACGGCGCTTGCGGAGAGCAAACAGCAAGAAGAC
AAATATCAGGCCAGTCATCCAAACCTCAGGAAACTGGAAA
CATCTGGATTCGGAGCTTCTGCTGCTCTTGATAACGGCTC
GTCTGATCAGAACGGATTTCCCAAAAACAAACAGCTGCGA
GCCGCTCACCAGCAGCTGGACAGAAACCTGGGTGAGAAAC
ACAAGAGCAGCTTCTCTCATACCTCCATCTGTGGAGTCCG
GATGTGACAGTGTGTGTGTGTGTGTTTGTGTCCTCCAGAT
GAGATGTCTCTGGGTCTGGGCCGGCTGAAGAATCTGGGTC
TGGGCCTGCAGACGGAGATCGATGAGCAGGACATTTCTCT
GGACGCTCTGCTTAATAAAGCCGACACCATGGACGGGAAG
ATCAGCTCCACCAACCGGCAGCTCAAAAGCCTTAAATAGA
CTCAGAGGGTGATGTCACTTCCTGGAGGCGTGGCCAAGGT
GATCATAATTGAAAACATGTGCGCTCGTAAAACATTTCTC
AAGTTCTCTCCAAGATAAGGAGGAGTGTGTTGGACAGAGA
AAGTTAAAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations