ZFIN ID: ZDB-TSCRIPT-090929-15398
Transcript Name: si:dkey-57a22.15-201
Previous Name: si:dkey-57a22.15-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034662 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034662|OTTDARG00000026185|ZDB-GENE-081104-427 si:dkey-57a22.15|OTTDARP00000027918 DKEY-57A22.15-001 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 680 bp
TCTCCAACGGAGACCATGGGCAAGATTGTTTTTTACGAGG
ACAAAAATTTCCAAGGTCGTAGTTATGAGTGCAGCAATGA
CTGCACAGACCTACACATTTACTTCAGTCGCTGCAACTCC
ATCAGAGTAGAGAGTGGCTGTTTCATGATCTATGAACGTC
CAAATTATATGGGCCACCAGTATTTTATGAAGCGAGGAGA
TTATTCTGACTACCAGAGATGGATGGGTTTCAGTAGCTCT
ATTCGATCCTGCCGAACAATTCCAATGTACAGGGGTCCAT
ATAGACTGAGGATCTATGAAAAGGCTGACTATGGAGGCCA
TATGATGGAGTTCATGGACGACTGCCCCTGTGTGTCTGAT
CGTTTCCACCATCGACATGTGTACTCCTGTAACGTGATGA
ACGGCTACTGGATCTTTTATGAATATCCCAACTACAAAGG
GAGGCAGTACTTCCTGAAATCTGGGGAATACAGGAGATAC
AGGGACTGGTGTGCCACGTGTGCAACTGTGGGCTCTTTCA
GACGAGTCACAGATTTCTAGCCATTCTTCTTGCACTTATT
TTTATGAACTGTTTATTTCCTGTTTATAAGCATAACTGTT
TATAAACAGCTTGATTTTTCACTTATTGTGCCTGGATATA
TATATAAAAAAACAGACGAATAAAATGATATTTGTAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-57a22.15-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034662 (1),  Ensembl_Trans:ENSDART00000091013 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH593171 (1) 702 nt
GenBank:EH610681 (1) 685 nt
GenBank:EB852809 (1) 520 nt
GenBank:EB865980 (1) 213 nt
CITATIONS (2)