ZFIN ID: ZDB-TSCRIPT-090929-15396
Transcript Name: zgc:162944-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034660 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034660|OTTDARG00000026183|ZDB-GENE-070424-75 zgc:162944|no_translation DKEY-57A22.8-002 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 778 bp
AGACTCTCTTCCGTCCGCTGTGGGTAGAGGCGCTGTTCAT
TCACGAACCTCGGAAGTTCGCATTGCAACCTTCAAGTTCA
CTTCAATTTTGTTGAGTTCGTGGTTCCAGTTTAAAAGCAT
GGGGAAGCGTGTAGCTGTCGTGCTGGCGGGCTGCGGAGTG
TTTGATGGAAGTGAAATCCATGAGGCGTCTGCGGTTCTGG
TTCATCTGAGCCGTCAGCAAGCCACTGTCAAGATGTTTGC
ACCCAACACTGACCAAATGCACGTTGTGGATCATCTGAAA
GGCTCTCCAACAGAGGAGAAGAGAAATGTGCTTGTGGAAA
GTGCCAGACTGGCCCGGGGTGAAATTGAAGACCTCAGCCA
GCTCAATGTGAAGGATCTGGATGCCATCATCTTCCCTGGT
GGTTTTGGAGCAGCCAAGAATTTGTGCAGCTGGGCAGTGG
ATGGCAAAGACTGCTCAGTCAATGATCAGGTGAAAGCAGT
GCTTCAGGCCTTTCATGCTGAGAAGAAGCCCATCGGCCTG
TGCTGCATCTCACCAGTGCTGGCGGCCAAAGTTTTCCCTG
GCTGTGAAGTGACCGTTGGTCATGTCACAGATGAGAGGTA
ACAATAAACACAGAGAAATCTCTTTAATCGGGTGTTTTCA
CACCTCCAGTTTGAAAAAAGTAAGAAAAGTCCAGCTGTGT
TTAGGTGGGAGTGTCCAGCGGCAAAAGAGGGAAGGGTTTG
TTTGAAAAGGGAAGTTTCATTACACGCAAAAAAGCTCATT
TGCACACCGGCAACTTCT

zgc:162944 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:162944-201 (1)    Ensembl 927
ncRNA zgc:162944-002 778
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:162944-002 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034660 (1),  Ensembl_Trans:ENSDART00000144447 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK360283 (1) 789 nt
CITATIONS (2)