ZFIN ID: ZDB-TSCRIPT-090929-15395
Transcript Name: zgc:162944-201
Previous Name: zgc:162944-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034659 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034659|OTTDARG00000026183|ZDB-GENE-070424-75 zgc:162944|OTTDARP00000027916 DKEY-57A22.8-001 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 927 bp
CGACGGTGTCAGACTCTCTTCCGTCCGCTGTGGGTAGAGG
CGCTGTTCATTCACGAACCTCGGAAGTTCGCATTGCAACC
TTCAAGTTCACTTCAATTTTGTTGAGTTCGTGGTTCCAGT
TTAAAAGCATGGGGAAGCGTGTAGCTGTCGTGCTGGCGGG
CTGCGGAGTGTTTGATGGAAGTGAAATCCATGAGGCGTCT
GCGGTTCTGGTTCATCTGAGCCGTCAGCAAGCCACTGTCA
AGATGTTTGCACCCAACACTGACCAAATGCACGTTGTGGA
TCATCTGAAAGGCTCTCCAACAGAGGAGAAGAGAAATGTG
CTTGTGGAAAGTGCCAGACTGGCCCGGGGTGAAATTGAAG
ACCTCAGCCAGCTCAATGTGAAGGATCTGGATGCCATCAT
CTTCCCTGGTGGTTTTGGAGCAGCCAAGAATTTGTGCAGC
TGGGCAGTGGATGGCAAAGACTGCTCAGTCAATGATCAGG
TGAAAGCAGTGCTTCAGGCCTTTCATGCTGAGAAGAAGCC
CATCGGCCTGTGCTGCATCTCACCAGTGCTGGCGGCCAAA
GTTTTCCCTGGCTGTGAAGTGACCGTTGGTCATGTCACAG
ATGAGAGGTATCCTGGTGTTCCGGACACAGCTGAAGCTAT
TACTCAGCTGGGCTGCAAGCACATATGTAAGCATGTGGAT
GAGGCTCATGTTGATGAGAAAAATAAGATCGTCACCACCT
GTGCTTTCATGTGCAACGCTCCACTGCATGAAATACATGA
TGGCATTGGAGTGATGGTGCAGGAGGTGCTGAAGCTTGCC
TGAATTCCTGCTAAGTCTTATTTTGTCTAATGTTTCTATA
GAAGGTCAAAGTCAACCCAAGTGTCATAAATGTCTCATTA
AGAACTTAATAGAAATGAATAAAGAGTACAACCCTTATTA
AAAATTT

zgc:162944 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:162944-201 927
ncRNA zgc:162944-002 (1)    Ensembl 778
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:162944-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034659 (1),  Ensembl_Trans:ENSDART00000101985 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH590716 (1) 938 nt
GenBank:BC135078 (1) 884 nt
GenBank:CT721839 (1) 582 nt
CITATIONS (2)