header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15175
Transcript Name: lacc1-202
Previous Names: lacc1-001, si:ch211-187f22.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034345 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034345|OTTDARG00000025971|ZDB-GENE-081104-155 lacc1|OTTDARP00000027709 CH211-187F22.1-001 LG_ BX957328.6 Danio rerio protein_coding NOVEL, 743 bp
ACTGCTTTGGCCATGGCTTCAGCACCCGTACCGGAGGGAT
CTCCTACATCAGCACCATGAGCTCAATGAACCTCTTCTGC
AACCCAAGGCGCAAAGACCCCAGAGCAGTGGTGGATGAAA
ATCGCCGGCGGCTCGGCCTGCAGGCTGGATTTCATTCTCG
TCAGTTAAACCTCATAAAGTGCAACCATGCCAGTGATGTG
TGGGTGATGGGCAAACCTGCCCCGGACAGTTACGATGGAC
TGGTGACCAATCAATCAGACGTTGTCATTGCAGCACCAGG
GGCTGATTGTATGCCATTGCTCTTCACTGACCCTGTATCA
AAGGTCATTGGAGTTGCGCATGCAGGCTGGAAGGGGACCC
TGATGGGAATCGCCATGGCAACAGTAAAAGCCATGGTGTC
AGAGTTTGGCAGCCGCCCTGCAGACATTGTGGTTGTGATT
GGGCCTTCTGTGGGACCCTGCTGCTTCACTCTGGAGCAGG
ACTCGGCCAGAGAGTTTCATTCCATACACCCGGACTGTGT
GCAAAACATGGAGTCATCCGAGCCTTCTGTCGACATCAGG
GTCGCTACTAGAGTTCTGCTGGAAAGAGGTGGGATTAAAC
CTGAGCACATAGAGAACATCCGAATCCCAAACCAGACGGA
TTCTATACCATGCACATCCTGCAGTCCTGAGCTATTCTTC
TCCCATAGGAGAGACGGACTCAACTTTGGGACACAGATTG
GGTTCCTGTGGATCAAGCCCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lacc1-202 Contained in:

OTHER lacc1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034345 (1)
  • Ensembl_Trans:ENSDART00000145174 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BQ614808 (1) 342bp
    GenBank:BQ618077 (1) 320bp
    CITATIONS (2)