ZFIN ID: ZDB-TSCRIPT-090929-14501
Transcript Name: ihha-201
Previous Name: ihha-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033551 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033551|OTTDARG00000025502|ZDB-GENE-051010-1 ihha|OTTDARP00000027148 ihha-001 LG_ BX942813.20 Danio rerio protein_coding KNOWN, 1600 bp
TAAATAAATGGACTTGCCCGCTCGCTCTCATTTGGGTGAT
TTTCTCGAGAGACCAGCGTTTCGCGTTTTATGGGCACTGA
ACATTTGGTATCACTGGATCTTTTCTCCGGCGGCTCTCCA
TGACTGGCTTTGCGTAAAGCGAATTTTACGCACGGACGAT
GGCACGGATAAGGCTAATAAAGAAGTAGAGGTTTTGTCCT
CCCCATCATTTACCCCGTGGGGGGGAAGAAGGATCTCGCG
GGGGGTAGTTTCTCAGTGAACGGCGAGCTGTGCCACCGTA
CCACTCCGCATCGGAGTGCCCGGCCGCTTGCGGTGGAATG
CGTCTCCCCGTGGTGTTTGGGCTCCTCGTCGGCTGCGCCC
TGATTTTCGCACCTGTTAACGAGGGCTGTGGGCCGGGGAG
GGGACATGGGAAAAGGCGGCCTCCGAAGAAACTGACACCC
CTTAATTACAAGCAGTTTAGTCCAAATGTAGCCGAGAAGA
CACTGGGAGCCAGCGGGAGAATCGAGGGCAAGATCACCAG
GAACTCAGAGCGCTTTAAAGAGCTCACGCCGAACTACAAC
CCGGACATCATCTTCAAAGATGAGGAGAACACAGGTGCGG
ATCGACTCATGACGCAGCGCTGTAAAGATAAGCTGAACTC
TCTGGCTATCTCTGTGATGAACATGTGGCCCGGGGTGAAG
CTCAGGGTGACCGAGGGTTGGGATGAAGACGGCAATCACT
TTGAAGATTCGCTGCATTACGAAGGAAGAGCTGTCGACAT
CACCACTTCTGATCGAGACCGTAATAAATATGGCATGTTG
GCCCGTCTTGCAGTGGAGGCCGGTTTTGATTGGGTCTACT
ATGAGTCCAAAGCTCACATCCACTGCAGCGTCAAGTCAGA
GCACTCTGTGGCTGCTAAAACCGGCGGTTGTTTTCCAGCA
TCGGCTCTCGTCACCGTTGAGGATGGAAGCTTGAAGACTT
TGGACAGCTTGCAGCCTGGAGAGAAAGTCCTGGCTTCATC
GGAAAGCGACGGAAGCGGGACGCTTGTGTACAGCGAGGTC
ATCGCCTTCCTGGACCGTGACCCTTCCGCAAGGAAGCAGT
TCTTCACCATTGAGACAGACTCTGGTGCGAAACTGAGCTT
GACGGCGGCTCATCTGCTGTTTGTATCTGAAGGGAACTGC
TCAGGGTCTGCAGCCAATGCAGAACTGCGGTCTGTATTTG
CTAGCGATGTGCTGCCAGGTCAGTGTGTGGTGTCCACACA
AGCAGCAGGACGGCACGGACGTTTATCACGGGTCTCTCGG
ATCCAAATGCAGGAGGACAGGGGGGTCTTCGCTCCACTCA
CCAGCCATGGGACGGTGGTGGTCAATGGCATTGTTTCCTC
CTGCTACGCAGCCGTGGACCAGCACTGGCTGGCTCACTGG
GCTTTCGGGCCACTCAGGGTACTTTATAACTGGGGAGGTC
CTGTTGGACATCAAGTCACAGGGATACACTGGTATTCCTC
ATTGCTTCACTGGATCGGAACTCAAGTGCTCGATCCAGCA
CACTTCCATCCTTGGAGCATGATGGACAATGATAGATGAA
AATAAGGGAGGAATGAGGAAGTTTCCAAAAAAAAAAAAAA

ihha TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ihha-201 1600
antisense ottdart00000059270 (1) 1666
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ihha-201 Contained in:
OTHER ihha-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000033551 (1)
  • Ensembl_Trans:ENSDART00000081660 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC133983 (1) 1616bp
    GenBank:DQ066428 (1) 1368bp
    CITATIONS (2)