Transcript

adcy8-204

ID
ZDB-TSCRIPT-090929-14271
Name
adcy8-204
Previous Names
  • adcy8-003
  • si:ch211-220f13.4-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033157 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033157|OTTDARG00000025196|ZDB-GENE-070912-197 adcy8|OTTDARP00000026823 CH211-220F13.4-003 LG_none BX005083.10,CU076109.8 Danio rerio protein_coding NOVEL, 738 bp
GGAGGTCTTCTCTCATTCTTCTATGTAAACAGCCTTTGAC
AGTGCTAGTGCTACGCTACAGAAAGACTCTGGCTGCGCTC
ACACGTCACTCCATTAACCTGCTCCCCAACCACCTGGCTC
AAGCCCTGCATGTGCGCGCCGGCTCACAGGAAATTAACGC
TCGCATGCAGAGCACCATCGCCCTGCGCAGCGGGGACAAG
CTCCGCCAAGAACATATCTCCCCCTTCTCTCTCACCTTTA
GAGAAGCACTGCTGGAGCACAAGTATTCCCAGATGAGAGA
TGAGGTGTTTAAGTCAAATCTAGTGTGTGCCTTCATTGTT
CTCTTCTTCATCACTGGAATACAGAGCTTACTTCCCTCTG
CAAGGATGGTAACGATGCTGATCCAGTTCTCTGTCCTCAT
CCTGCTGCACTGCTGCCTTGTTGTTGTGACCACTGCCGAG
GATTACAAGTGTTTGCCGCTGGTTTTGCGTAAAGCGTGCT
GCTGGGTGAATGAAACCTACGCCGCGCGGAACGTCGTCAT
CTTCCTGTCCATCCTTATTAACTTTCTGGCTGCCATGATC
AACATACTTTGGTGTGATTTTGATAAATCGGGCTCATTCA
GGAACCAGACGTTTAATGCATCCGCCTCAATCCCAGATAT
CTGCTTCTACCCAGAGTATTTCGTGTTTACCGGAGTGCTG
GCGATGGTGACCTGTGCGGTTTTTCTCCGACTGAATTCAG
TTTTGAAGTTGGCGATCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations