header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14212
Transcript Name: gbp2-202
Previous Names: gbp2-001, si:dkey-97a13.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033078 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033078|OTTDARG00000025139|ZDB-GENE-070912-618 gbp2|OTTDARP00000026751 DKEY-97A13.8-001 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 2410 bp
CGTGTCGGATCAATTCAGACTCTGGGAAGGTTATTTTGCA
GTTGTATACAACAAAAGCTTTTCTTTGCTGCTTCTTTGCT
CTTTTGTTGACTCATCTACCTGAATAAGATATTAGTTTTA
AGTTATGGCTTTTGGTCGGCACATGTCTGCTCCGGTGTGT
CTCATCGAAAATGACGAATTTGGGAAGCTGTGTGTGAAGA
AAGAGGCAAAAGACATTCTGGATGAGATCAATGAGCCGGT
GGTGGTGGTGTCTGTGGTGGGACTCTACCGTACGGGAAAG
TCTTACCTTATGAACCGCCTGGCAGGAAAACAATCTGGCT
TTGCTCTCGGCAGCACCATTGAGTCAAAGACCAAAGGCAT
CTGGATGTGGTGTGTCCCCCACCCGTATAAAAAAGGACAC
ACTCTGGTGCTGCTGGACACAGAGGGACTGGGTGATGTGG
ACAAGGGGGATGAGAGGCATGACACATGGATCTTCTGTCT
GGCTGTTCTTCTCAGCAGCGCTCTGGTCTACAACAGTTTA
GGGGTCATTGATAACATGGCACTGGAAAAGCTGCACTACG
TCACAGAGCTGACGGAGAACATCCGTGTAAAGGCAGAAGG
TAATGAAGTTGAAGATGAAGATGAATCAGCAGAATTCATG
CGTGTTTTCCCATCGTTTGTCTGGGCTGTTCGAGACTTTA
CTCTGGAGTTGAAAATGGGGGACAAACCAATAACATCAGA
CGAGTATCTGGAGAGTGCACTGAAGCCAAAAAAAGGAAAC
TCACCTCAGATAGCGCAGTATAACCTGCCACGCCGCTGTT
TGCGTGAGTTTTTTGCGCCGAGGAAGTGCTTTGTGTTTCC
TCGACCTGCCAGTACACAAGACATGAAAAGAATGGAGGAT
CTGACTGAGGAAGAGCTGGATTCAGAGTTCCTTCAGCAAG
CAAACACTTTCTGCAGTTACATTTACAATAGTACAGAGCC
AAAAACTGTCAAAGGAGGACGTACAATTACAGGAACAGCT
CTAGGAAATCTTGCTGAGGTTTACGTCGAGGCGATCCGCA
GTGGGAAAGTTCCTTGTCTGGAAAATGCAGTAGTGTCTCT
GGCTAAGATCCAGAATGTCCGTGCTGTTGAACAAGCTCTG
CAGATTTACATGACAGAGATGCTCAGCATGGCTCAGTTTC
CACTGGACCCAGAAGAGCTTTCCAGCATCCACACATTAGC
AGAGAAGAAAGCCATCGAAGAGTTCATCAACATGTCCTTC
AGTGATAATGACCAGATCTACCAGCAAGAGCTCATGGGGA
AGATTCATAATGAATATCAGGATCTGTGCCAGCAGAATCA
TCAAGCATCTCTCATGCAGTGTCAGGAGGTTCTGGAGGAT
GTGTTTGATCCACTGGAAATGAACATTTCTAATGGATCAT
ACCTGAGGCCTGGAGGATACAGAGAGTACAGAGCCTTGCT
CGCACAGCTGACAAGTTCTTACAGAGCAAGAACAAAGTCA
CAGATAATGAGTGAGGAAGTGTTGTGTATGTTTTTGAAAG
GAAAGGAAGATGTTGGGAATATGATTCTACAGGCTGATGA
ATCTCTCAGTGCAGCAGAGCAGGAGAAAGAGGTGCAGATG
TTAAAGAATGAAATACTGCAACAGCGGCAAAGAGGCCTGG
AGGAGCAGAACCGCTTGCAGGAGCAGGCCTTTAAAGACAT
GGAGAGAACACACCAGGAGCATGTGAATCAGATCGTTCAT
CAGATGGAGAGAGAGCAGGAGAGAATCAGGAGAGACAATG
AGCGGGTCCTGGAGGCCAAACTCAAGGAAAGGGAGGCTCT
TCTAAAGCAGGGCTTCGAGGAAGAGGCCTCCCGAATGCAG
AAAGAGATTAACAGTCTGAAAACAGACATGAGTAAACAGG
AGGAGTCTAAGCCCTCGACTATGAGAAAGGTTTTAGACGG
CATCGGCACTGCAGCCACGTTGTTTTTGCCGGGCTTCATT
CCTAAAGCAGCTGGTATTGGTTTATCTTTCTTATCAAGGC
TGTTTTGAAAATCTGTTATTTACACTCGCTCTCCTAAACA
TAGATATAGTTTTTCCAAGACAACTTGAATTCTTTAATAG
TTACATATATATACATTTATAGGTGCTGTACTCGCAGATA
CTATTACATTAATAGCCCAGTAATACAGTATTATCCAAGC
AAGTAGGACATTTTGTTATGAATTATGACCAAGGATGTTA
TTAATATGATTTCAAACTGATATGCATCATTCGTTGAATC
CCAGTGTAAATCATCCTGGAACCTGTGGCTGTGTTGTGTT
GAGATTATAACACTGGGTGATTATACAGTTTGCTGATTTA
AAAAAAAAAAGCTATGTACTGTGTATTGTACTTTTCTTTG
TTTATTTAACACTAAATGTTCTTCAACACAGTTTAGAGCA
GGGGTGGGCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gbp2-202 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033078 (1),  Ensembl_Trans:ENSDART00000143562 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT708904 (1) 811 bp
GenBank:DT082378 (1) 768 bp
GenBank:EH997177 (1) 747 bp
GenBank:EB791581 (1) 516 bp
GenBank:EB985327 (1) 494 bp
GenBank:EB924032 (1) 480 bp
GenBank:EB916098 (1) 328 bp
CITATIONS (2)