Transcript

gbp2-202

ID
ZDB-TSCRIPT-090929-14212
Name
gbp2-202
Previous Names
  • gbp2-001
  • si:dkey-97a13.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033078 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033078|OTTDARG00000025139|ZDB-GENE-070912-618 gbp2|OTTDARP00000026751 DKEY-97A13.8-001 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 2410 bp
CGTGTCGGATCAATTCAGACTCTGGGAAGGTTATTTTGCA
GTTGTATACAACAAAAGCTTTTCTTTGCTGCTTCTTTGCT
CTTTTGTTGACTCATCTACCTGAATAAGATATTAGTTTTA
AGTTATGGCTTTTGGTCGGCACATGTCTGCTCCGGTGTGT
CTCATCGAAAATGACGAATTTGGGAAGCTGTGTGTGAAGA
AAGAGGCAAAAGACATTCTGGATGAGATCAATGAGCCGGT
GGTGGTGGTGTCTGTGGTGGGACTCTACCGTACGGGAAAG
TCTTACCTTATGAACCGCCTGGCAGGAAAACAATCTGGCT
TTGCTCTCGGCAGCACCATTGAGTCAAAGACCAAAGGCAT
CTGGATGTGGTGTGTCCCCCACCCGTATAAAAAAGGACAC
ACTCTGGTGCTGCTGGACACAGAGGGACTGGGTGATGTGG
ACAAGGGGGATGAGAGGCATGACACATGGATCTTCTGTCT
GGCTGTTCTTCTCAGCAGCGCTCTGGTCTACAACAGTTTA
GGGGTCATTGATAACATGGCACTGGAAAAGCTGCACTACG
TCACAGAGCTGACGGAGAACATCCGTGTAAAGGCAGAAGG
TAATGAAGTTGAAGATGAAGATGAATCAGCAGAATTCATG
CGTGTTTTCCCATCGTTTGTCTGGGCTGTTCGAGACTTTA
CTCTGGAGTTGAAAATGGGGGACAAACCAATAACATCAGA
CGAGTATCTGGAGAGTGCACTGAAGCCAAAAAAAGGAAAC
TCACCTCAGATAGCGCAGTATAACCTGCCACGCCGCTGTT
TGCGTGAGTTTTTTGCGCCGAGGAAGTGCTTTGTGTTTCC
TCGACCTGCCAGTACACAAGACATGAAAAGAATGGAGGAT
CTGACTGAGGAAGAGCTGGATTCAGAGTTCCTTCAGCAAG
CAAACACTTTCTGCAGTTACATTTACAATAGTACAGAGCC
AAAAACTGTCAAAGGAGGACGTACAATTACAGGAACAGCT
CTAGGAAATCTTGCTGAGGTTTACGTCGAGGCGATCCGCA
GTGGGAAAGTTCCTTGTCTGGAAAATGCAGTAGTGTCTCT
GGCTAAGATCCAGAATGTCCGTGCTGTTGAACAAGCTCTG
CAGATTTACATGACAGAGATGCTCAGCATGGCTCAGTTTC
CACTGGACCCAGAAGAGCTTTCCAGCATCCACACATTAGC
AGAGAAGAAAGCCATCGAAGAGTTCATCAACATGTCCTTC
AGTGATAATGACCAGATCTACCAGCAAGAGCTCATGGGGA
AGATTCATAATGAATATCAGGATCTGTGCCAGCAGAATCA
TCAAGCATCTCTCATGCAGTGTCAGGAGGTTCTGGAGGAT
GTGTTTGATCCACTGGAAATGAACATTTCTAATGGATCAT
ACCTGAGGCCTGGAGGATACAGAGAGTACAGAGCCTTGCT
CGCACAGCTGACAAGTTCTTACAGAGCAAGAACAAAGTCA
CAGATAATGAGTGAGGAAGTGTTGTGTATGTTTTTGAAAG
GAAAGGAAGATGTTGGGAATATGATTCTACAGGCTGATGA
ATCTCTCAGTGCAGCAGAGCAGGAGAAAGAGGTGCAGATG
TTAAAGAATGAAATACTGCAACAGCGGCAAAGAGGCCTGG
AGGAGCAGAACCGCTTGCAGGAGCAGGCCTTTAAAGACAT
GGAGAGAACACACCAGGAGCATGTGAATCAGATCGTTCAT
CAGATGGAGAGAGAGCAGGAGAGAATCAGGAGAGACAATG
AGCGGGTCCTGGAGGCCAAACTCAAGGAAAGGGAGGCTCT
TCTAAAGCAGGGCTTCGAGGAAGAGGCCTCCCGAATGCAG
AAAGAGATTAACAGTCTGAAAACAGACATGAGTAAACAGG
AGGAGTCTAAGCCCTCGACTATGAGAAAGGTTTTAGACGG
CATCGGCACTGCAGCCACGTTGTTTTTGCCGGGCTTCATT
CCTAAAGCAGCTGGTATTGGTTTATCTTTCTTATCAAGGC
TGTTTTGAAAATCTGTTATTTACACTCGCTCTCCTAAACA
TAGATATAGTTTTTCCAAGACAACTTGAATTCTTTAATAG
TTACATATATATACATTTATAGGTGCTGTACTCGCAGATA
CTATTACATTAATAGCCCAGTAATACAGTATTATCCAAGC
AAGTAGGACATTTTGTTATGAATTATGACCAAGGATGTTA
TTAATATGATTTCAAACTGATATGCATCATTCGTTGAATC
CCAGTGTAAATCATCCTGGAACCTGTGGCTGTGTTGTGTT
GAGATTATAACACTGGGTGATTATACAGTTTGCTGATTTA
AAAAAAAAAAGCTATGTACTGTGTATTGTACTTTTCTTTG
TTTATTTAACACTAAATGTTCTTCAACACAGTTTAGAGCA
GGGGTGGGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations