header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14202
Transcript Name: si:dkey-97a13.12-201
Previous Name: si:dkey-97a13.12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033068 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033068|OTTDARG00000025131|ZDB-GENE-070912-614 si:dkey-97a13.12|OTTDARP00000026742 DKEY-97A13.12-001 LG_ BX663525.6 Danio rerio protein_coding PUTATIVE, 876 bp
AAGCCAGGAGAAGCAGAGACTTTGCCTCCACAGCGTTCAT
TCAAATCAAAGCACAGGTGTTTGGATTAAGTTTGAGTTTC
CTGACTTCATCATGCAGCAGATCTACATGCAAAGCCATGA
AGAGTTCGAAGTGTTCACCACTGTGCTTTCTCCTCAAGTG
TGTCGAAAGAGGGTGATATTCAAACACCAAGGAGAAATGA
TGGATGTGGCAGCAGACTACAGTGCAGACTGTGATGAAGA
AGTGAGTGTTCGCGTCGGGGAGGCTGTATTAATGCTGTAC
CAGGAAAATGCTGACTGGTGTTACGTGCGACTTCATGGTG
GCAAAGAGGGATACTTGCCCACAGCCTGCTTTACTGCGAA
GCAGGATCCATTAAGGCCGATGGTGACTCCTCCGGCGCAG
AGCTCAGTGTCTTCTAATGATCGCAGCAGATGTGCAGGAG
GGCGCTCTCTCCGGTTGCCCCGCCGCGCGTCTCTGCCGGC
GGTACCGGCGGGCTCTCCTCGGTTACTACAGCGGCTGCTC
TCTCGCCCGCGGCGGCGCAGCGACGGACAGGCCGTGCGCT
CAATTGGCTCCATTAACCCGGCATTTCACCCAGACTGACG
AAAGCTCTACTTTTATCATTGGAAATGGGTTACAGATCGG
CAGAAATAGGACAGCGTGACACCAATGTTTGTCACAGCTC
CTTTTTCAGTTGACAGAAAAGGACTTTTTTGGGTGTCCTG
ATTCGGGTTTGGGGTCTTGGTAACTGGTGGAAGGAGTCTT
TACTATTACTGGCCCTCATGTAAATATTGTGATCTTGATT
GCAAAGTTTTACAATGCAGTTATTATGAAATGACATCACA
CTATTATTCATCTACAAAGGTATTTGAGTATTTATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-97a13.12-201 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033068 (1),  Ensembl_Trans:ENSDART00000142663 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK363530 (1) 847 bp
GenBank:EB955078 (1) 655 bp
GenBank:EB960328 (1) 557 bp
CITATIONS (2)