header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14187
Transcript Name: ebi3-201
Previous Name: ebi3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033052 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033052|OTTDARG00000025118|ZDB-GENE-070912-615 ebi3|OTTDARP00000026728 DKEY-97A13.4-001 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 1036 bp
TGTGACTACAGTACGTTCAATTTTAGTTTGTTCTTTTTAA
AAAGAACCTCTATGTATTTGTGAGTATAACAATGTGCTTA
ATATACGTTTTTGGAGCACTGGTCATAACAAGTGGAGTTT
TTTGCCAAGGCACGGCAGCTTTACAGCCAGCGGTTCGAGA
CCTGTTTGTAGCAGTGGGTTCATCTGTGAAGATACCATGC
ACTGACGGAGAGGAAAAAGGGGTGGAGTGGAGATTTAACA
GCTCAGTGCTTGTCTCAAGCCCAGTTATCTCCATACAGAA
CGCCAGTTTGAAGGACCAAGGCATCTACACCTGCCAAAAG
CAGACTGGAGATGTGGTGCAATCTGTATCTCTACATCTGG
GATATCCCCCATCTCCCCCGCATGTGCATTGTTGGTCTCC
AAGTTACCCTAAGAGGGCAATCTGTTCTTGGACACTGACT
TCAGACCCAATACTTCCAACCCAGTATATTGCTACATACA
GGAACTTTTCAGACCCAGTTTCAAGTGCTCGTCAATGCCA
GAAATGGGGAGACCAAGACAGGCAATGTGCATTAGAGGAA
CTGGAGATATTTGCGAGAGAACCAACTCTTATCAACATCA
CAGCGGTTAATGCTCTCGGTAGCGCAACACAAATCCAACC
ATTTATTTTTGAGCAAATAGTGAAACCTGATCCTCCGGAG
AATGTCAGCGGGATAATAATGCCAGGCAGGAAGGTGTCTG
TGCAGTGGAGTCCACCGCACACATGGCCAGATCCTGTCAA
CTTTCTCCTTAAATACAAAGTCAGATTCCACTGGGGCAAA
CCGGAAACTGCTAGAACTCTGGGCCCTTACGAGTCTAATA
AAATGGTTCTGAGTGGACTGGTGGCAGGAAGGACGTATTA
CATCCAAATATCAGCAAAGGACATTCTTGATGATGGACAG
AGCAGTGAATGGAGTGCACCAATACACATCACTATACCTA
CTATACTATACCTAAAGTGATGGATCTCGGCTTCAACCAT
TCTGTCAATAAACTCAATAAATTATTGCTATTATTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ebi3-201 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033052 (1),  Ensembl_Trans:ENSDART00000075673 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH507824 (1) 1027 bp
GenBank:EH533969 (1) 902 bp
GenBank:DT060274 (1) 769 bp
CITATIONS (2)