header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12834
Transcript Name: wisp1a-202
Previous Names: wisp1-001, wisp1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030676 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030676|OTTDARG00000023525|ZDB-GENE-070705-178 wisp1a|OTTDARP00000024979 CH211-38F10.2-001 LG_ CT573122.7 Danio rerio protein_coding NOVEL, 928 bp
CACTGAAGAACCCATCACCCCGCAGCCCTATAATCGCAGC
CAGTACTGCCAATGGCCCTGCAAATGCCCCAAAACTCCTC
CCATGTGCCCGCCAGGTGTCAGTCTGCTTATGGATGGCTG
CGATTGCTGCAGAGCCTGTGCCAAACAGGTCAGGGAGGCT
TGCAATGAGAAAGAAAACTGTGACCATCATCGCGGCCTTT
ACTGTGATTACAGTGCAGACAAGCCTAGGTACGAAAAAGG
AGTATGTGCGTTTCTGCCAGGCACTGGCTGTGAGCACAAT
GGTGTGATTTATCGCAATGGACAGAGCTTTCAGCCCAACT
GCAAATATCAGTGTCTTTGTGTGAACGGGGCGATCGGGTG
TGTGCCGTTGTGCAATGAGTCTCAGCCGCCCAGGGTTTGG
TGCCAGAACCCGCAGAGGGTTAAAGTCCACGGCCAATGCT
CTCTGTCCAGCGTGAAGAAGAACTGGCATAAGAACTGTGT
GGCCCAGACAACCTCTTGGAGTCCCTGCTCGAAGACCTGC
GGTCGTGGCGTCTCTTTACGAATCACCAACAACAACAAAA
AGTGTGAGATGGTCAACGAGAGCAGACTCTGCAACATCCG
GCCCTGCAATGTGGATATCACGAAACACATCAAGCCTGGA
AAGAAGTGCTTGAACATCTACAGAGCAGAGAAGCCTCAAA
ACTTCACCATCTCAGGCTGCACCAGCACAAACACCTACCG
GCCCAAGTACTGTGGAGTGTGTACAGACGAGCGCTGCTGC
ATCCCCTACAAATCCAAAACTATTGAAGTCGACTTCCAGT
GCCCGAACGGCCCCGGATTCACCTGGCAGGTCATGTGGAT
CAATGCCTGCTTCTGCAACCTGAGTTGTAAGAACCCTAAT
GACATATTTACTGATCTAGAACAGTACCATGAGAAGCGGG
AGATCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wisp1a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030676 (1),  Ensembl_Trans:ENSDART00000147714 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)