header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12750
Transcript Name: si:dkey-228a15.1-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030578 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030578|OTTDARG00000015704|ZDB-GENE-060503-344 si:dkey-228a15.1|no_translation DKEY-228A15.1-004 LG_none CT027569.12,CR749752.5 Danio rerio protein_coding KNOWN, 944 bp
AGACGTTGCGGTAGTTTTGACAGTGAAGGAAGCTTCAATT
CTGATTACTGCAGAGGATGGCGCAGAAGATGACAAATGTC
AATCCAGCTGGTAACAGGACAGTTCCTGATTTTGGAAAGA
TGTATTATGTCAAAGGTACACTACCAGTCGATCCCAGTTG
TAAGAGTAACAAATAATAGCTTGACTTCTAGTTAATCATT
TGAAAAGTGGCAGAAGGTGGATTTTTTCAGATGAATCATC
TGTTGAACTGCATCCCAATCATCACACATACTGCAGAAGA
CCTGTTACCTCCACATCAAAGTTGCTGAAAGCAAAGAAGG
TCAAAGTTCTCCAGGATTGGCCAGCTCAGTCACCAGAAAT
GAACATTATTGAGCATGTCTTGGGTAAGATGGAGGAGGCA
TTGAAGATGAATCCAAAGAATCTTGATGAACTCTGGGAGT
CCTGCAAGTGTAATTTCATTGCCTTCCTATGAGATAGAAG
AACCTTTTGAAGCTTGGTACGACTTTGAGGGGAACAGAAG
TCGCATCGACTACTATAATGGTACAACGCGCACATTTCTG
ATTGGAAATGACTTGGATTATGGGGCCATTTACCAAATCA
AACCAGTCCTTCCTCCCAGCGATATTAAGTGTTTCCAGCT
TAAAGGTACCAAAGAGGAACCGATACGGCCACAGTCAGCA
ATGCCTGATGTACAGGGATTTGAGTTTGAGAAGATGGAGG
ATTGCAAAGGTGCTCAGTGTGAGGTCTGGAAAACCATCAC
AGAGGCTGGCCATAAGAAGAACACATACCGTCTGTGGGTC
ACACGTCCAGAGGGAAATGATGCTCCAGCCACACCACACC
GCTTTGAGATGGAGGGCTTCAACACTCTTCTAGATTCCCA
CAATGACAAATACAGCATTGAGTACAGTGACTTCAGCTCA
CAAACTGAGCCTGATGTTTTCACT

si:dkey-228a15.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-228a15.1-004 944
mRNA si:dkey-228a15.1-202 (1) 863
si:dkey-228a15.1-203 (1) 1559
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-228a15.1-004 Contained in:
OTHER si:dkey-228a15.1-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030578 (1)
  • Ensembl_Trans:ENSDART00000132825 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH590766 (1) 969bp
    CITATIONS (2)