header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12460
Transcript Name: si:dkey-46g23.2-201
Previous Name: si:dkey-46g23.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030205 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030205|OTTDARG00000023222|ZDB-GENE-070705-476 si:dkey-46g23.2|OTTDARP00000024619 DKEY-46G23.2-001 LG_ BX322654.15 Danio rerio protein_coding NOVEL, 4517 bp
ATTGTTAGAGCTCTGTTGGGTTCATCATTTGAGGATTACA
GTAGTCACTTTGAAGGGTTTCTGAAGGAGAAAACCTTGGA
TGATTGCTCATCATGGCGATGATGGAGATCAGTGTTTGGA
AGTGGATCAATCTAGTCCTTTTCTTCTGTTTTGTTGATGG
TGCCATGCTTGCTTTGGATGCCCCAAGACCAAGAGAACCG
GTGGTCACTGCTGATGAACAGATCTCAGGGCCGCTCATCA
TGGTGACGTTTCCTTCATTGATTGAGTCCGGCTCTGGTGC
TAAACTGTGCGCTAGTCTTCTGAAGCCCCAAGGCAGTCTG
ACAATAACCATTACTCTGATAGATGACAAAAGCGCAGAAA
CTCAACTCGCGCGTCAGACAACCCAGAGAAAGCTCCACAG
ATGTTTTAATTTCCAGGCTCCTCTTGTAAGTGGAGATTCG
GTGCAGACTGTGAGGGTGGTCGTTCAAGGACAGTCCTTCA
AAATGACTGAAGAGCGTAAAGTGATGTTCAGGTCTTACCT
GCCTCTGACCTTCATCCAGACAGACAAACCGCTCTACAAT
CCAGGACAGACAGTGAATTTCAGAGTCGTCACCATGAGTG
ATAAACTTGTGCCTCTTGACCAAATGTACAATCTGGTGGT
GTTGGAGGACTTTCGTAATATCCGGATAAATCAGTGGACA
AATGTTTCCTCCGTGAACTGGATATTGGAGCTTTCTCATG
TTTTGATCCCAGAAGCTCAGGTTGGGACGTACACATTGAG
GGCTTATATTGGTGACCGAATCATCTCCCAGAGTTTTGAT
GTGAAACAATACGTTTTACCCAAGTTTGATGTGACCGTGA
ACGCACCACAGACGTATAGTGTCGCAGATGTGGGACTGAA
AGTTGAGGCTTGTGGAAAGTACACATTTGGGCAGCCTGTA
CCTGGTCAAGTGCTGGTGGAAGTGTGCCGTCAGCCTTTTA
CCTTTGCTCAGGATCCTAAAGTGACCAGCATTTGTCTGAT
TAAATCCACTAAGACAAACAACACTGGCTGTGCCTCTCTA
ACACTCAGTACATCGTCGTTTTTTGGCACCAGTTTTGAGA
GTAACCTGCAGAATTCCTTCGTTGTTAATGTCAACCTCAC
TGAGGAGGGAACAGGTGTGGTCATGTCAAAATCCACAACG
GTGTCGATTACATTTGAAGTTGGCAAGGTCACATTTGTGG
ATCTCCCAAAGTTCTATAATTATGGGTCAACGGTGAATGG
CAAGATCTCGGTGTCTGATTTTAATGGAAACCCAATCAAT
AGCAAGGCTGTTTATCTCCTGGACAGCAGCATATGGCCCA
ACAAACTGCTGTTCAATTTGACCACGAACAAGAACGGATT
TGCCAAGTTCTCCCTTGACACGACTAGTTTTCCTCAAGCT
GATCTGAATCTTGTGGCAAGTGCAACTCCACAGTCTTATT
TCAGCTCCAATTCGCCATACTTCACTACAGATTCACAGGT
GGTTCAGCTTTCCCAAACTGATCCTGACACCCCAACCTTT
AGTGATCTGTCTATAGTGAAGCTTGAGCAGCCGCTGAAGT
GTGGCACCACTTATTCAGTGACTGTCAAGTATTTATTTGT
TGGAGAGACTGGCGACTACAGTGCTGACATCATCTATATG
GTCATGTCCAGGGGAGTCATCGTTCTGCATGGGTTTAAAA
CTGTTCAAGCTCGGGCTTCTAATACCCTCACAAAAGGCAC
GGTGACATTTGATCTCTCAATTCTTGCCAAAATGGCTCCG
GTGGTTCAGATTCTGGTCTACAGTGTTCTGCCCAGTCAGA
CTGTAGTTACCGGTAGTGCATTGTTTGACACTGAGAAGTG
CTTCGCAAACCAGGTTTCTCTGCAGTTCTCTCCTGCTTCA
GCGGTTCCTGGTGAGGGAAGTATTTTGACTGTCTCCGCTC
AAGCCGGATCTCTGTGTGGCCTCAGTGCTATAGATCAGAG
TGTTCTGATCATGCAGTCAGGAGGACGTCTGAGCGCAGAG
GCGGTGTTTAACATGCTTCCACTGCAATCACTATCTGATT
ATCCATTCGGTGCTGAAGATCAACAAAACTGCCTAAATGT
TCGACCCCGTCGAGCTGTTCCAACAGATCAAGCTTATAAC
ACCTTCAAAAGTGTGGGGATCAAGATTGCAACAAATCTGC
CAGTTCGAGAGCCTGAGTGCCTTAAGTTCAAAGACCTGCT
TTACTATCGCAACTTCCATGGGGTGTTTCCTTTACGGGAG
GTTGCTTTTGCTGTTTCTGGAAAGGCTCCCGCTCCATTAG
CAATGGCAGAAATGGCTGGAACTGGAGGTTCCTCTGTTGT
GACACTCAGGACCTACTTTCCAGAAACATGGATCTGGCAA
CTCTCTCTTGTGGGGGACTCTGGGTCCACATCAGTTCCCC
TCACGGTTCCTGATACGATCACCACATGGGACACTGAAGC
CTTCTGTCTCTCCTCCAATGGTTTTGGCCTGGCTCCACCA
GCTCTGCTGACTTCCTTCCAGCCCTTCTTCCTAGAGCTCA
CCCTGCCTTACTCCATAATCCGTGGGGAGGCTTTTGAGCT
AGTGGCCACAGTCTTCAACTATCTGTTGCAATGCATCAAG
ATTCAAGTGACTCCAACACCATCCTCCAACTACACTCTAA
CACCCATCAATGATCAGTCTTCATCTACTCTCTCTACCAA
TTGGAGAAAAACCATCAAATGGGCTTTAACTGCTTCTGTT
ATTGGAACTGTAAACGTGACCATTAGTGCTGAGGCCAGTC
CATCCCAGGAATTGTGTGGCGATCAGGATGTGACTGTACC
ATCAAGAGGACGCATTGACATAGTCACTCGAAGTCTGCGA
GTTCTGGCTGAAGGAGTGGAAAGGACCTTCACACGGAGTT
GGTTACTCTGTCCAAAGGGAAGCATGCTTTCAGAGAGTGT
GAAGATCACACTTCCTACAAATGTCATCCAGGGATCAGCC
AGCTGTTCTGTATCAGTCATTGGGGACATCATGGGTCGTG
CTCTGAATAACCTGGCCAATTTGCTACAGATGCCTTCTGG
CTGTGGAGAACAGAACATGATCATTCTCGCTCCCAATGTT
TACATCCTACGGTATCTGACAGTAACTGCACAGCTCACCC
CAGCCATCCGAGACACTGCAACTGGCTATCTTCTGACTGG
ATATCAAGGACAGCTGAACTACAGGCACAGTGATGGTTCA
TTCAGCACTTTTGGCTATGATCCATCCAATACATGGTTGA
CCGCCTTTGTCATGAGGACTTTTGGTCTAGCAAGGAGCTT
CACCTACATAGACCCCAATGTTCTTGCGGGTGCAAAGAAC
TGGTTAATTAGCACGCAGGGTTCAGATGGCTGTTTCGTGC
AGCAGGGCACTCTATACCACAATGACATGAAGGGTGGAGT
TGGTGATAACGTGACCATGACTGGCTACATCGTTGCATCA
CTGCTTGAAATAGGCGTCCCTGTCACAGATCCTGTCATTA
CTAAGGCTCTGTCGTTTTTGAGGCCTCTTGTTGGGAATCT
GGGAAACACCTATGTCACTGCTCTGCTGGCCCACACCTTC
AGTCTGGCTGGAGAGACCAACACTCGAGCACAGCTTTTAA
GTTCCTTGAGAAACACTGCCATTTCTGAAGGTACTACTCT
CCACTGGTCTCAGACGACATCTGGGGATACTCTGGCAGTG
GAGATCAGTGCATATGTGCTGTTAGCGGTTCTCACTGTAC
AGCCTGTGACCACTGCTAATCTGGGCTATGCTAACCGCAT
TGTCAACTGGATTGTGGCCCAGCAGAATCCCTATGGTGGT
TTCTCCTCTACTCAGGACACCGTGGTGGCTCTTCAGGCCT
TGGCTCTGTACGCTGCTCAAGCGTTTACCCCTGGAGGCTC
CAGCACCGTTACAGTTCAGTCCTCAGTGCCAGCAGGAGAC
ATTTTCAACTTTGCTGTGACTCCCAACAACCGCCTGCTGT
ACCAGAGAAATTCCCTGAACAACTTCCCTGGCACATATAG
TGTTGTAGCAAGGGGATCTGCCTGTGCTTCTGTGCAGGTT
GCCTGTTTCTACAACATCCCTACTCCTGTTATGGTTGCCA
GAACCCTCAGTGTTGTTGCAAAGGTGTCTGGAGACTGCCA
GGCTGCACCAGTCAATCTGATGTTGACCTTCACAGTAAAA
TACAATGGTCGAAAGCCAACTACTAACATGGTTCTGGTGG
ACATCAAGGTTTTGTCAGGATTCACTGCAGACACCTCACT
GCTTGGATCCCCACCTAATTTCGCTCCGTTAGTGCAGAGG
GTTGATTCGAATGGTGATCATGTCCTTGTCTATCTACAAG
AGGTTCCCAAAGGTGTTCCAGTGACCTTCAGTATACAGCT
GACACAGACTGTTGCAGTGCAGAATCTCAAGCCAGCGGTC
ATCAATATCTATGACTATTACCAGAGAAATGATAAATTTG
AGACCACGTACAAATCCCCCTGTCCATGATTGTGCTTCAA
TGTTTTATTCCAGAAATAAATTCACTTGAATCAATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-46g23.2-201 Contained in:
[BAC] DKEY-46G23 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030205 (1),  Ensembl_Trans:ENSDART00000047865 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH443831 (1) 996 bp
GenBank:EE720268 (1) 927 bp
GenBank:EG571621 (1) 919 bp
GenBank:CD759403 (1) 915 bp
GenBank:EG575299 (1) 905 bp
GenBank:EE698658 (1) 870 bp
GenBank:CT636293 (1) 700 bp
GenBank:BG738220 (1) 602 bp
GenBank:EG578115 (1) 601 bp
GenBank:DY572778 (1) 526 bp
GenBank:BI867972 (1) 500 bp
GenBank:CT625080 (1) 462 bp
GenBank:CD600294 (1) 419 bp
CITATIONS (2)