ZFIN ID: ZDB-TSCRIPT-090929-1244
Transcript Name: galnt8b.2-001
Previous Names: galnt8b-001, si:ch211-214j24.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000008576 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000008576|OTTDARG00000007593|ZDB-GENE-041210-84 galnt8b.2|OTTDARP00000007396 galnt8b-001 LG_ BX323558.7 Danio rerio protein_coding KNOWN, 1972 bp
TGCACAAACCCGAAGCACTCAACAAACAAGAGCGATAACA
TAATTCAGTGAAGTCTTGCAGAGTAGCTGGCACTTGAAGA
TGCACAGAAAACAAACTTTCTCTGATTTATTTCATTTAAT
TTGCTTGTTTCTCTATTAAATTATTGATCATCATGAGGAT
AAGCTTTGCAAAGAGTTTGTTTCCAGTTTTGTCTGTCGCT
GTGGTTTTTCTCTATTTGAGCTCTGTGAAATGGGAGATAA
AAACGCAAGAGGAGAAACTTCAGCGAGTCCAGCAGAACTT
GTCACTGCACAGCTCTCTTCTGCTCCACAAGCTGGACAAA
CTGGAGGCTCATTTGATCGCTGTGGAAGAGACACGCCTCA
ATGTAAAAAATGAGAAGAAACCAGCAAAGAAACTATTCCC
AGATTCATACCTCTTCAAGAGATGGAGTGTGGAGCTTTCA
GAGGATGAGCAGAGGAAAGCTGAGGATCTCTTTCAGAAAT
ACGGATATAACGCCTTCCTCAGTGACCGACTGCCTCTGGA
CCGAGAGCTGCCGGACACTCGAGACCACAGATGCGCTGAG
CGTGAATATCCTCCCGATCTGCCCACCGTCAGTGTGGTGC
TGATTTATCTGGACGAGGCTCTGTCTGTCATTCAGAGAGC
CGTTTACAGCATCATCAACAGAACTCCAGCTCATCTGCTG
AAAGAGATCATACTGGTGGACGACCACAGCACTAACGAGG
ATCTGCAGACGCAGCTGCATGTTTACATCAGCTCCATCAA
TGAGAAGCACCCAGGCCTGGTGAAGATGGTGACCCATGCA
GAACAGAAAGGCCTCTCGCAGGCCAGGATCTCAGGCTGGA
AGGCTGCCAGCGGCGACGTGGTCGCCATTCTGGACGCCCA
CATTGAGGTCCATGTCAAATGGGCGGAGCCTCTACTTGCA
CGCATCCAGGCTGATCGCACGCTAGTCTTGAGTCCTGTGT
TTGATAAAATTAATTATGACGATCTGGAGGTGACTAAATA
CATTGCCTCTGCTCATGGTTTTGACTGGGCTCTCTGGTGT
ATGTATGTGACATTCCCGGAGAAGTGGTACAATCAAAACG
ACCCTTCGCTGCCAGGAAAGAGTCCCTCTGTAATGGGAAT
ACTGGTGGTGGATCGTCTGTTCTTCGGTGAGATCGGGACT
CTGGATGAAGGGATGCAGGTGTACGGAGGAGAGAATGTTG
AATTGGGAATACGGGTGTGGCTGTGTGGAGGGAGTATAGA
GGTTGTGCCCTGCTCCAAAATCGCACACATTGAAAGAGCG
CACAAACCCTACATGCCCGACCTGAGTAACGTCATGAAGA
GAAACGCCCTCAGAGTGGCCGAAGTTTGGATGGACGAGTA
CAAGAAAAATGTCTACATGGCTTGGGGGCTTCCCATGCAG
AATCATGGGATAGACATTGGTGACTTATCAGAGAGAAAGA
AACTGAGAGAGAGGCTGAACTGCAAACGGTTTAAATGGTA
TCTGGAAAATGTCTATAATTTGTTAAACCCCATGGATGAT
TTGCTTGGTTATGGATCGCTGATTAATGATCTGCAAACAA
GTCTATGTTTGGACAAAGGGCCGTCAGAGGAGAACACTCC
CATTTTATATCCATGCCATTTTTTAATCTCACAGCAATTT
TTCTATACAACAAGTGGAGAGATATTAGTCGGTCCCCTTC
AGCCCCTTTTACACAGCCGAAACCGCTGTCTAGCTGATCC
AGGATCGGGCCGGTTTCCAGAGTTTTCCTGGTGTTCAGAC
ACAGAGAAACCAAAACACATGTACTGGGACTTCAAACAGG
GACAGGCCATACAGAACAGAGACACCAAGCGCTGTCTGGA
GATCAGCACCAAACAGACAGGAGACTATAAAAATAACGTT
TTCATTCAGCAGTGCAGAAACCAACACTGGAGGATACAAC
ATGCAATTCGGGACTTTTAAGCACAAAATATAATAAATTG
TTTGTAAAGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
galnt8b.2-001 Contained in:
OTHER galnt8b.2-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000008576 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB871394 (1) 395bp
    CITATIONS (1)