header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12424
Transcript Name: jph2-201
Previous Name: jph2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030166 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030166|OTTDARG00000023192|ZDB-GENE-030131-9848 jph2|OTTDARP00000024576 DKEY-18F23.8-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 3105 bp
GGAGAGGGGAGAGGGGTTGAAAAGCCATGATCTATTCGAT
TAAATAGATCATTGTAAACAGAAAGCAACAAGATTATGTA
ACTAAAAACAAAAAGCTAAAAAACAATCCTCCCTCTCCTA
AGTCACTTCAACTACAAGACGTTTGATTCAGCATTTAAGG
ATATAGCCTATACAAAATCAGCAAATGATGAGCGACGACT
CTCCAAGTCAGCGCGAGGAAAAAAGGATCGGCTCTCTCCG
GTTTACGCATGGATTTAACAGCGCCCGGTAGAGGTTAATC
GGTAAATTATAGTTTTTTTAAGTTTGAGAGTTTCGGAAGT
TATTGGTGATTGCAGTGAGAAGTGATGAGCGGAGGTCGCT
TTGAGTTTGATGATGGCGGAGCTTATTGTGGAGGCTGGGA
GGGAGGAAAAGCGCACGGACACGGGATCTGCACCGGACCC
AAAGGACAAGGAGAGTTCTCCGGCTCTTGGAATTACGGGT
TCGAGGTGGTCGGAGTCTACACATGGCCGAGTGGAAACAC
GTATGAGGGCTATTGGTCCCAGGGGAAGCGTCACGGTTTA
GGTGTGGAGACCAAGGGTCACTGGATCTACAAGGGAGAGT
GGACGCACGGCTTCAAAGGCAGATACGGGACGCGCATCAG
TCAGGGAAGTGGCGCCAAGTACGAGGGCACTTGGAATAAC
GGACTGCAAGATGGTTACGGCACCGAGACCTACGCTGATG
GCGGTACCTTCCAGGGCCAGTTCACAGGTGGCATGCGGCA
CGGCTATGGAGTACGTCAAAGCGTTCCCTATGGTATGGCA
GCAGTGGTGCATTCTCCCCTGCGCAACTCTCTTAGCTCCC
TACGTAGTGAACACAGCAATGGCACACTCCTCCAGCAGGA
CGTCCCGGTCATCACCACCACCAATGCCTCAGGCCAGGAG
ACTCCAGTCAATTTACCCATGCCTCTGGGGCCATCCCGTG
GTGGCTTTGCCCTCACCCTGCAAGTGGACCCAGATGCGGT
CAAGCCCAAGAAAAGTGGTCTCTTCCGCCGCGGCTCATTT
CTTGGCAAGCTAAAAAAGTCTGATTCCCGCACGTCTCTCT
CCAGCCAGAAGAGCAAGATCAGCTTTTTGCGGACTGAGTC
AGCATTGAGTTCTGCTGCCAGTGATGCAAACTCCACCATC
AGCCTGGGCGAGAGCGAGGGTGAAGGCGAAGGTCATAACT
TTCCCCCCGTAGAGGCAGACATTGATGCCACCACCACTGA
GGTCTACATGGGAGAGTGGAAAAATGACAAGCGTTCAGGG
TACGGGATCAGCGAACGCTCTAGTGGGCTTAAATATGAGG
GTGAGTGGCTCAATAACCAGCGCCACGGTTATGGGTGCAC
CACTTTCCCAGAGGGGGGAAAAGAAGAAGGCAAGTATGTC
AACAACATGCTCGTGAAGTCTGTGAAGAAGAAGATGATAC
AGCTGAAGGGCACAAAAATTAAACAGAAAGTGGAGCGCAG
TTTGGAAGGGGCACAGAGAGCAGCCGCTATTGCGAAACAG
AAGGCTGAAATCGCCAACTCAAGAACGGCCCATGCCAAAA
GTAAAGGAGACGCTGCAGAACAGGCTGCTGTAGCCGCTAA
TAATGAGTCCAGTATCGCTCGAGTGGTTGCCAGAGAGCTC
TCTCCCTCTTTCCATCAACCAGGTCCTGAGTATATTAAAA
AGCGAGCCTTGCAGGAGGTTGCAGAGAGCAATGAGAACAT
GGAAACAGGCATTCACGAGCCCTTGTTGGCTGAGGACTCC
CTGCCAACACCTCCGGAAAGCCCATTCATGCATGAGATGG
AAGGTCTGAGACCAAGCTCCACTCCTGCACGCACCCCCTC
ACCCACCCTAGTCATTGTCCCTCAAGCACCAAGCAAGGAT
GATCCTCACCTCTTGAGCCCTGGGAGCTGGAATGGAGACA
AGATCAGTAGGGGCAGTGCTAGTAAAAGCAGCAGTAGAGC
AGGTAGTCGGCCAAATAGTAGACCCATCACTCCTGCTGCT
GCTCCCACTCCAGATGCTGCTCCAGAAGAACACTCTGCCC
CAAGTAGCAAGGTCCCATCTCGCACCCCTAGCCGCCAGAG
TGCCAAAGTGGAGCAGGGTTCAGACATGGAAATCAAAGCT
CTGCAGAAAACGGACATAGAGTCAAAAGTGGCAGAACCTG
CCCCTGTTGCTAAACCAGTAAGAACCAACCTCATCCTTCC
CAATGATGAAGAAGAACCACCACGTCCTGCACCCAAGCTT
TCGCCCAAAGCAGCCACACCTGAGCCAAAGGCAGCAGAAG
TCAAGCATAGAGCTGACACAAGGCAGCCCATAAATGAGCG
CCCTGCTTCTATGACAGAAAGCAAGCCTGAGTATAGGACA
GACGTCAGGGAGGAGAAGAAATTTATCAACAAAGTTGAGC
CTAAACCTTCACCGAAACGAGAACCAAGCCCTGCCCCAAA
AGTCACACCAAAGCCTGAACCCAAGACAGTGCCTAAACCA
GAACCAAAACCTGTGGTCATGCCGGTTGCAAAACCTGTTG
CCAAGGTGGAGGCCAAAACTGAAACAAGGCAGAGGTCTAT
TATGAAAGCCCCGAGTGAAATGACACAACCATCTATGGAG
CTAGAAGAGGGGCCAAACACGATTATGATCTGCATGGTTA
TATTCCTGAACATCGGTTTGGCGATTCTTTTCGTTCACAT
CTTGTCTTGAGGTGACAAAATCTAAGCCAAAACCATCCAG
GTGAAAGAAACTACCATGGGGAGCTGTGAGGAAGCACTGC
GCTCCATTAACGGCTCTGTTGTTGCGTTATCCAGTTTCAG
AACAGCCCTCCTGAGCTACTCTGAAGATGGTTGCCATCTG
TAATTGGACCGAGTGCTCCCAAATGATCAGTGTGCCTCAG
TGCCTGAACATTACAGAATGAAGCATTTCTGCACATTTGC
TTTGTTTCTAAAAGGTACTGCTGCATTTAACAGGTCTGTT
AAAGTCTATTGCAGCTGGAGCTGAATCGTCTATAATAAGG
GCTAATTCACGTTGTGCACGTCACGTTCTATAAAGCAAAA
CATGTCACTTGGCATGTAACATTCATCTCTGGAGAATAAA
TAAGTAGTTGTGATGGTAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jph2-201 Contained in:
OTHER jph2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030166 (1)
  • Ensembl_Trans:ENSDART00000043429 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139533 (1) 3122bp
    GenBank:DY562059 (1) 818bp
    GenBank:CK705131 (1) 767bp
    GenBank:EE708779 (1) 578bp
    GenBank:CK705085 (1) 512bp
    GenBank:AL920381 (1) 339bp
    CITATIONS (2)